array:24 [
  "pii" => "S1579212913001882"
  "issn" => "15792129"
  "doi" => "10.1016/j.arbr.2013.10.006"
  "estado" => "S300"
  "fechaPublicacion" => "2013-12-01"
  "aid" => "818"
  "copyright" => "SEPAR"
  "copyrightAnyo" => "2013"
  "documento" => "article"
  "crossmark" => 0
  "subdocumento" => "sco"
  "cita" => "Arch Bronconeumol. 2013;49:551-2"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:2 [
    "total" => 2945
    "formatos" => array:3 [
      "EPUB" => 118
      "HTML" => 2162
      "PDF" => 665
    ]
  ]
  "Traduccion" => array:1 [
    "es" => array:19 [
      "pii" => "S0300289613002378"
      "issn" => "03002896"
      "doi" => "10.1016/j.arbres.2013.07.016"
      "estado" => "S300"
      "fechaPublicacion" => "2013-12-01"
      "aid" => "818"
      "copyright" => "SEPAR"
      "documento" => "article"
      "crossmark" => 0
      "subdocumento" => "sco"
      "cita" => "Arch Bronconeumol. 2013;49:551-2"
      "abierto" => array:3 [
        "ES" => true
        "ES2" => true
        "LATM" => true
      ]
      "gratuito" => true
      "lecturas" => array:2 [
        "total" => 5799
        "formatos" => array:3 [
          "EPUB" => 127
          "HTML" => 5064
          "PDF" => 608
        ]
      ]
      "es" => array:11 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Imagen cl&#237;nica</span>"
        "titulo" => "Aneurisma de la arteria pulmonar"
        "tienePdf" => "es"
        "tieneTextoCompleto" => "es"
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "551"
            "paginaFinal" => "552"
          ]
        ]
        "titulosAlternativos" => array:1 [
          "en" => array:1 [
            "titulo" => "Pulmonary Artery Aneurysm"
          ]
        ]
        "contieneTextoCompleto" => array:1 [
          "es" => true
        ]
        "contienePdf" => array:1 [
          "es" => true
        ]
        "resumenGrafico" => array:2 [
          "original" => 0
          "multimedia" => array:7 [
            "identificador" => "fig0005"
            "etiqueta" => "Figura 1"
            "tipo" => "MULTIMEDIAFIGURA"
            "mostrarFloat" => true
            "mostrarDisplay" => false
            "figura" => array:1 [
              0 => array:4 [
                "imagen" => "gr1.jpeg"
                "Alto" => 573
                "Ancho" => 2600
                "Tamanyo" => 183554
              ]
            ]
            "descripcion" => array:1 [
              "es" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Rx t&#243;rax PA &#40;A&#41; y lateral &#40;B&#41; en la que se visualiza lesi&#243;n redondeada de perfiles lisos localizada a nivel del hilio izquierdo en la proyecci&#243;n PA &#40;flechas 1A&#41;&#44; que se proyecta al espacio retroesternal &#40;flecha 1B&#41;&#46; La TC tor&#225;cica con la administraci&#243;n de CIV&#44; proyecci&#243;n sagital y axial &#40;C-D&#41; confirma la dilataci&#243;n aneurism&#225;tica del cono de la arteria pulmonar&#46;</p>"
            ]
          ]
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "Victoria Mayoral-Campos, Jos&#233; Luis de Benito-Ar&#233;valo, Marzo Antonio Varea-Sanz"
            "autores" => array:3 [
              0 => array:2 [
                "nombre" => "Victoria"
                "apellidos" => "Mayoral-Campos"
              ]
              1 => array:2 [
                "nombre" => "Jos&#233; Luis"
                "apellidos" => "de Benito-Ar&#233;valo"
              ]
              2 => array:2 [
                "nombre" => "Marzo Antonio"
                "apellidos" => "Varea-Sanz"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "es"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S1579212913001882"
          "doi" => "10.1016/j.arbr.2013.10.006"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => false
            "ES2" => false
            "LATM" => false
          ]
          "gratuito" => false
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001882?idApp=UINPBA00003Z"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289613002378?idApp=UINPBA00003Z"
      "url" => "/03002896/0000004900000012/v1_201312040037/S0300289613002378/v1_201312040037/es/main.assets"
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S1579212913001766"
    "issn" => "15792129"
    "doi" => "10.1016/j.arbr.2013.10.001"
    "estado" => "S300"
    "fechaPublicacion" => "2013-12-01"
    "aid" => "770"
    "copyright" => "SEPAR"
    "documento" => "simple-article"
    "crossmark" => 0
    "subdocumento" => "cor"
    "cita" => "Arch Bronconeumol. 2013;49:553-4"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:2 [
      "total" => 11060
      "formatos" => array:3 [
        "EPUB" => 141
        "HTML" => 10221
        "PDF" => 698
      ]
    ]
    "en" => array:11 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Letter to the Editor</span>"
      "titulo" => "Inverted Intercostal Hernia of Soft Tissue of the Chest Wall&#58; Multi-Detector Computed Tomography Findings"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "553"
          "paginaFinal" => "554"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Hernia intercostal invertida de tejido blando de la pared tor&#225;cica&#58; hallazgos en la tomograf&#237;a computarizada multidetector"
        ]
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Fig&#46; 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 2106
              "Ancho" => 2045
              "Tamanyo" => 461461
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Axial &#40;A&#41; and sagittal &#40;B&#41; CT with contrast&#44; with reconstructions &#40;C&#44;D&#41;&#44; in which a convex lens-shaped herniation and incarceration of soft tissue of the right posterior wall of the thorax &#40;subcutaneous fat layer and major rhomboid muscle&#41; can be observed in the pleural cavity via the widened space between the sixth and eighth ribs&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Ulysses S&#46; Torres, Eduardo Portela-Oliveira, Fernanda del Campo Braojos, Luciana Vargas Cardoso, Arthur Soares Souza"
          "autores" => array:5 [
            0 => array:2 [
              "nombre" => "Ulysses S&#46;"
              "apellidos" => "Torres"
            ]
            1 => array:2 [
              "nombre" => "Eduardo"
              "apellidos" => "Portela-Oliveira"
            ]
            2 => array:2 [
              "nombre" => "Fernanda"
              "apellidos" => "del Campo Braojos"
            ]
            3 => array:2 [
              "nombre" => "Luciana"
              "apellidos" => "Vargas Cardoso"
            ]
            4 => array:3 [
              "nombre" => "Arthur"
              "apellidos" => "Soares Souza"
              "sufijo" => "Jr&#46;"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "es" => array:9 [
        "pii" => "S0300289613001002"
        "doi" => "10.1016/j.arbres.2013.02.010"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => true
          "ES2" => true
          "LATM" => true
        ]
        "gratuito" => true
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "es"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289613001002?idApp=UINPBA00003Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001766?idApp=UINPBA00003Z"
    "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001766/v1_201312010030/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1579212913001924"
    "issn" => "15792129"
    "doi" => "10.1016/j.arbr.2013.10.010"
    "estado" => "S300"
    "fechaPublicacion" => "2013-12-01"
    "aid" => "784"
    "copyright" => "SEPAR"
    "documento" => "simple-article"
    "crossmark" => 0
    "subdocumento" => "crp"
    "cita" => "Arch Bronconeumol. 2013;49:548-50"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:2 [
      "total" => 4405
      "formatos" => array:3 [
        "EPUB" => 120
        "HTML" => 3201
        "PDF" => 1084
      ]
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Case report</span>"
      "titulo" => "Alpha-1-Antitrypsin Deficiency Associated With the Mattawa Variant"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "548"
          "paginaFinal" => "550"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "D&#233;ficit de alfa-1-antitripsina asociado a la variante Matawa"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Fig&#46; 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1104
              "Ancho" => 2599
              "Tamanyo" => 274980
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Sequence corresponding to exon 5 SERPINA1&#46; &#40;A&#41; Normal sequence&#46; &#40;B&#41; Sequence corresponding to the patient&#44; which shows insertion of a thymine &#40;T&#41; instead of an adenine &#40;A&#41; at codon 376 in exon 5 of heterozygosity for the PI-Mattawa allele&#46; The SERPINA1 gene coding sequence &#40;exons 2&#8211;5&#41; was analyzed using previously described primers for exons 3&#8211;5 and 5&#8242;ACGTGGTGTCAATCCCTGATCACTG3&#8242; Ex2F primers and ex2R 5&#8242;TATGGGAACAGCTGG3&#8242; for exon 2&#44; with reference to the comparative SERPINA1&#95;Transcript&#95;ENST00000440909&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Beatriz Lara, Beatriz Mart&#237;nez-Delgado, Maria Luisa Torres, Sandra Mar&#237;n-Arguedas, Ana Bustamante, Marc Miravitlles"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Beatriz"
              "apellidos" => "Lara"
            ]
            1 => array:2 [
              "nombre" => "Beatriz"
              "apellidos" => "Mart&#237;nez-Delgado"
            ]
            2 => array:2 [
              "nombre" => "Maria Luisa"
              "apellidos" => "Torres"
            ]
            3 => array:2 [
              "nombre" => "Sandra"
              "apellidos" => "Mar&#237;n-Arguedas"
            ]
            4 => array:2 [
              "nombre" => "Ana"
              "apellidos" => "Bustamante"
            ]
            5 => array:2 [
              "nombre" => "Marc"
              "apellidos" => "Miravitlles"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "es" => array:9 [
        "pii" => "S030028961300152X"
        "doi" => "10.1016/j.arbres.2013.05.004"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => true
          "ES2" => true
          "LATM" => true
        ]
        "gratuito" => true
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "es"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S030028961300152X?idApp=UINPBA00003Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001924?idApp=UINPBA00003Z"
    "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001924/v1_201312010030/en/main.assets"
  ]
  "en" => array:14 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Clinical Image</span>"
    "titulo" => "Pulmonary Artery Aneurysm"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "551"
        "paginaFinal" => "552"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Victoria Mayoral-Campos, Jos&#233; Luis de Benito-Ar&#233;valo, Marzo Antonio Varea-Sanz"
        "autores" => array:3 [
          0 => array:4 [
            "nombre" => "Victoria"
            "apellidos" => "Mayoral-Campos"
            "email" => array:1 [
              0 => "vickymayoral&#64;gmail&#46;com"
            ]
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">¿</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
          1 => array:2 [
            "nombre" => "Jos&#233; Luis"
            "apellidos" => "de Benito-Ar&#233;valo"
          ]
          2 => array:2 [
            "nombre" => "Marzo Antonio"
            "apellidos" => "Varea-Sanz"
          ]
        ]
        "afiliaciones" => array:1 [
          0 => array:2 [
            "entidad" => "Servicio de Radiolog&#237;a&#44; Hospital Cl&#237;nico Universitario Lozano Blesa&#44; Zaragoza&#44; Spain"
            "identificador" => "aff0005"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Aneurisma de la arteria pulmonar"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 716
            "Ancho" => 3250
            "Tamanyo" => 276617
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Chest X-ray&#44; posterior&#8211;anterior &#40;PA&#41; &#40;A&#41; and lateral &#40;B&#41;&#44; in which a smooth rounded lesion at the level of the left hilum can be seen in the PA projection &#40;arrows 1A&#41;&#44; projecting into the retrosternal space &#40;arrow 1B&#41;&#46; Chest CT with the administration of intravenous contrast&#44; sagittal and axial projection &#40;C and D&#41; confirms an aneurysmatic dilatation of the conus arteriosus&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><p id="par0005" class="elsevierStylePara elsevierViewall">We present the case of a 77-year-old patient with a history of hypertension and glaucoma&#44; who was admitted to our hospital for symptoms of dyspnea at rest&#44; with no cough or expectoration&#46; As a casual finding on the chest radiograph &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>A and B&#41;&#44; a saccular image was observed with well-defined borders at the level of the left hilum &#40;arrows 1A&#41;&#44; extending toward the retrosternal space &#40;arrow 1B&#41;&#46; It was decided to complete the study with chest-computed tomography &#40;CT&#41; with intravenous iodated contrast &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>C and D&#41;&#44; in which an aneurysmatic dilatation of the conus arteriosus&#44; 75<span class="elsevierStyleHsp" style=""></span>mm in diameter &#40;<span class="elsevierStyleItalic">p</span>&#41;&#44; was reported&#44; with no other findings of interest&#46; Due to the patient&#39;s clinical history &#40;asymptomatic&#44; located in the pulmonary trunk&#44; with no data indicating a high risk of rupture&#41;&#44; it was decided to opt for a conservative approach to the aneurysm&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0010" class="elsevierStylePara elsevierViewall">Pulmonary artery aneurysms are rare entities<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> and are difficult to diagnose due to their low prevalence&#44; as they often present with non-specific symptoms or even in asymptomatic patients&#46;<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a> Only isolated cases have been documented in the world literature&#44; and their management remains unclear&#46;</p></span>"
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "NotaPie" => array:1 [
      0 => array:2 [
        "etiqueta" => "&#9734;"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Please cite this article as&#58; Mayoral-Campos V&#44; de Benito-Ar&#233;valo JL&#44; Varea-Sanz MA&#46; Aneurisma de la arteria pulmonar&#46; Arch Bronconeumol&#46; 2013&#59;49&#58;551&#8211;552&#46;</p>"
      ]
    ]
    "multimedia" => array:1 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 716
            "Ancho" => 3250
            "Tamanyo" => 276617
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Chest X-ray&#44; posterior&#8211;anterior &#40;PA&#41; &#40;A&#41; and lateral &#40;B&#41;&#44; in which a smooth rounded lesion at the level of the left hilum can be seen in the PA projection &#40;arrows 1A&#41;&#44; projecting into the retrosternal space &#40;arrow 1B&#41;&#46; Chest CT with the administration of intravenous contrast&#44; sagittal and axial projection &#40;C and D&#41; confirms an aneurysmatic dilatation of the conus arteriosus&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:2 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Idiopathic pulmonary artery aneurysm"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "G&#46; Orman"
                            1 => "T&#46;S&#46; Guvenc"
                            2 => "B&#46; Balci"
                            3 => "M&#46; Duymus"
                            4 => "T&#46; Sevingil"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.athoracsur.2012.08.044"
                      "Revista" => array:7 [
                        "tituloSerie" => "Ann Thorac Surg"
                        "fecha" => "2013"
                        "volumen" => "95"
                        "paginaInicial" => "e33"
                        "paginaFinal" => "e34"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23336912"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0022534709005448"
                          "estado" => "S300"
                          "issn" => "00225347"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Idiopathic pulmonary artery aneurysm&#58; report of a case and review of the literature"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;E&#46; Tom&#225;s Labat"
                            1 => "S&#46; Beltr&#225;n Beltr&#225;n"
                            2 => "S&#46; Molina Naveros"
                            3 => "F&#46; Navarro Botella"
                            4 => "D&#46; Alvarez Soto"
                            5 => "E&#46; P&#233;rez Moro"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "An Med Interna"
                        "fecha" => "2005"
                        "volumen" => "22"
                        "paginaInicial" => "329"
                        "paginaFinal" => "331"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16288578"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001882/v1_201312010030/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "21342"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Clinical Image"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/15792129/0000004900000012/v1_201312010030/S1579212913001882/v1_201312010030/en/main.pdf?idApp=UINPBA00003Z&text.app=https://archbronconeumol.org/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001882?idApp=UINPBA00003Z"
]
Share
Journal Information
Vol. 49. Issue 12.
Pages 551-552 (December 2013)
Vol. 49. Issue 12.
Pages 551-552 (December 2013)
Clinical Image
Full text access
Pulmonary Artery Aneurysm
Aneurisma de la arteria pulmonar
Visits
5542
Victoria Mayoral-Campos
Corresponding author
vickymayoral@gmail.com

Corresponding author.
, José Luis de Benito-Arévalo, Marzo Antonio Varea-Sanz
Servicio de Radiología, Hospital Clínico Universitario Lozano Blesa, Zaragoza, Spain
This item has received
Article information
Full Text
Bibliography
Download PDF
Statistics
Figures (1)
Full Text

We present the case of a 77-year-old patient with a history of hypertension and glaucoma, who was admitted to our hospital for symptoms of dyspnea at rest, with no cough or expectoration. As a casual finding on the chest radiograph (Fig. 1A and B), a saccular image was observed with well-defined borders at the level of the left hilum (arrows 1A), extending toward the retrosternal space (arrow 1B). It was decided to complete the study with chest-computed tomography (CT) with intravenous iodated contrast (Fig. 1C and D), in which an aneurysmatic dilatation of the conus arteriosus, 75mm in diameter (p), was reported, with no other findings of interest. Due to the patient's clinical history (asymptomatic, located in the pulmonary trunk, with no data indicating a high risk of rupture), it was decided to opt for a conservative approach to the aneurysm.

Fig. 1.

Chest X-ray, posterior–anterior (PA) (A) and lateral (B), in which a smooth rounded lesion at the level of the left hilum can be seen in the PA projection (arrows 1A), projecting into the retrosternal space (arrow 1B). Chest CT with the administration of intravenous contrast, sagittal and axial projection (C and D) confirms an aneurysmatic dilatation of the conus arteriosus.

(0.26MB).

Pulmonary artery aneurysms are rare entities1 and are difficult to diagnose due to their low prevalence, as they often present with non-specific symptoms or even in asymptomatic patients.2 Only isolated cases have been documented in the world literature, and their management remains unclear.

References
[1]
G. Orman, T.S. Guvenc, B. Balci, M. Duymus, T. Sevingil.
Idiopathic pulmonary artery aneurysm.
Ann Thorac Surg, 95 (2013), pp. e33-e34
[2]
M.E. Tomás Labat, S. Beltrán Beltrán, S. Molina Naveros, F. Navarro Botella, D. Alvarez Soto, E. Pérez Moro, et al.
Idiopathic pulmonary artery aneurysm: report of a case and review of the literature.
An Med Interna, 22 (2005), pp. 329-331

Please cite this article as: Mayoral-Campos V, de Benito-Arévalo JL, Varea-Sanz MA. Aneurisma de la arteria pulmonar. Arch Bronconeumol. 2013;49:551–552.

Copyright © 2013. SEPAR
Archivos de Bronconeumología
Article options
Tools

Are you a health professional able to prescribe or dispense drugs?