Clinical Image
Pulmonary Artery Aneurysm
Aneurisma de la arteria pulmonar
Victoria Mayoral-Campos
, José Luis de Benito-Arévalo, Marzo Antonio Varea-Sanz
Corresponding author
Servicio de Radiología, Hospital Clínico Universitario Lozano Blesa, Zaragoza, Spain
Read
5542
Timeswas read the article
1923
Total PDF
3619
Total HTML
Share statistics
array:24 [ "pii" => "S1579212913001882" "issn" => "15792129" "doi" => "10.1016/j.arbr.2013.10.006" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "818" "copyright" => "SEPAR" "copyrightAnyo" => "2013" "documento" => "article" "crossmark" => 0 "subdocumento" => "sco" "cita" => "Arch Bronconeumol. 2013;49:551-2" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 2945 "formatos" => array:3 [ "EPUB" => 118 "HTML" => 2162 "PDF" => 665 ] ] "Traduccion" => array:1 [ "es" => array:19 [ "pii" => "S0300289613002378" "issn" => "03002896" "doi" => "10.1016/j.arbres.2013.07.016" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "818" "copyright" => "SEPAR" "documento" => "article" "crossmark" => 0 "subdocumento" => "sco" "cita" => "Arch Bronconeumol. 2013;49:551-2" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 5799 "formatos" => array:3 [ "EPUB" => 127 "HTML" => 5064 "PDF" => 608 ] ] "es" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Imagen clínica</span>" "titulo" => "Aneurisma de la arteria pulmonar" "tienePdf" => "es" "tieneTextoCompleto" => "es" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "551" "paginaFinal" => "552" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Pulmonary Artery Aneurysm" ] ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 573 "Ancho" => 2600 "Tamanyo" => 183554 ] ] "descripcion" => array:1 [ "es" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Rx tórax PA (A) y lateral (B) en la que se visualiza lesión redondeada de perfiles lisos localizada a nivel del hilio izquierdo en la proyección PA (flechas 1A), que se proyecta al espacio retroesternal (flecha 1B). La TC torácica con la administración de CIV, proyección sagital y axial (C-D) confirma la dilatación aneurismática del cono de la arteria pulmonar.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Victoria Mayoral-Campos, José Luis de Benito-Arévalo, Marzo Antonio Varea-Sanz" "autores" => array:3 [ 0 => array:2 [ "nombre" => "Victoria" "apellidos" => "Mayoral-Campos" ] 1 => array:2 [ "nombre" => "José Luis" "apellidos" => "de Benito-Arévalo" ] 2 => array:2 [ "nombre" => "Marzo Antonio" "apellidos" => "Varea-Sanz" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S1579212913001882" "doi" => "10.1016/j.arbr.2013.10.006" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001882?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289613002378?idApp=UINPBA00003Z" "url" => "/03002896/0000004900000012/v1_201312040037/S0300289613002378/v1_201312040037/es/main.assets" ] ] "itemSiguiente" => array:19 [ "pii" => "S1579212913001766" "issn" => "15792129" "doi" => "10.1016/j.arbr.2013.10.001" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "770" "copyright" => "SEPAR" "documento" => "simple-article" "crossmark" => 0 "subdocumento" => "cor" "cita" => "Arch Bronconeumol. 2013;49:553-4" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 11060 "formatos" => array:3 [ "EPUB" => 141 "HTML" => 10221 "PDF" => 698 ] ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Letter to the Editor</span>" "titulo" => "Inverted Intercostal Hernia of Soft Tissue of the Chest Wall: Multi-Detector Computed Tomography Findings" "tienePdf" => "en" "tieneTextoCompleto" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "553" "paginaFinal" => "554" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Hernia intercostal invertida de tejido blando de la pared torácica: hallazgos en la tomografía computarizada multidetector" ] ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2106 "Ancho" => 2045 "Tamanyo" => 461461 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Axial (A) and sagittal (B) CT with contrast, with reconstructions (C,D), in which a convex lens-shaped herniation and incarceration of soft tissue of the right posterior wall of the thorax (subcutaneous fat layer and major rhomboid muscle) can be observed in the pleural cavity via the widened space between the sixth and eighth ribs.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Ulysses S. Torres, Eduardo Portela-Oliveira, Fernanda del Campo Braojos, Luciana Vargas Cardoso, Arthur Soares Souza" "autores" => array:5 [ 0 => array:2 [ "nombre" => "Ulysses S." "apellidos" => "Torres" ] 1 => array:2 [ "nombre" => "Eduardo" "apellidos" => "Portela-Oliveira" ] 2 => array:2 [ "nombre" => "Fernanda" "apellidos" => "del Campo Braojos" ] 3 => array:2 [ "nombre" => "Luciana" "apellidos" => "Vargas Cardoso" ] 4 => array:3 [ "nombre" => "Arthur" "apellidos" => "Soares Souza" "sufijo" => "Jr." ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S0300289613001002" "doi" => "10.1016/j.arbres.2013.02.010" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289613001002?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001766?idApp=UINPBA00003Z" "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001766/v1_201312010030/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1579212913001924" "issn" => "15792129" "doi" => "10.1016/j.arbr.2013.10.010" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "784" "copyright" => "SEPAR" "documento" => "simple-article" "crossmark" => 0 "subdocumento" => "crp" "cita" => "Arch Bronconeumol. 2013;49:548-50" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 4405 "formatos" => array:3 [ "EPUB" => 120 "HTML" => 3201 "PDF" => 1084 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Case report</span>" "titulo" => "Alpha-1-Antitrypsin Deficiency Associated With the Mattawa Variant" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "548" "paginaFinal" => "550" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Déficit de alfa-1-antitripsina asociado a la variante Matawa" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1104 "Ancho" => 2599 "Tamanyo" => 274980 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Sequence corresponding to exon 5 SERPINA1. (A) Normal sequence. (B) Sequence corresponding to the patient, which shows insertion of a thymine (T) instead of an adenine (A) at codon 376 in exon 5 of heterozygosity for the PI-Mattawa allele. The SERPINA1 gene coding sequence (exons 2–5) was analyzed using previously described primers for exons 3–5 and 5′ACGTGGTGTCAATCCCTGATCACTG3′ Ex2F primers and ex2R 5′TATGGGAACAGCTGG3′ for exon 2, with reference to the comparative SERPINA1_Transcript_ENST00000440909.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Beatriz Lara, Beatriz Martínez-Delgado, Maria Luisa Torres, Sandra Marín-Arguedas, Ana Bustamante, Marc Miravitlles" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Beatriz" "apellidos" => "Lara" ] 1 => array:2 [ "nombre" => "Beatriz" "apellidos" => "Martínez-Delgado" ] 2 => array:2 [ "nombre" => "Maria Luisa" "apellidos" => "Torres" ] 3 => array:2 [ "nombre" => "Sandra" "apellidos" => "Marín-Arguedas" ] 4 => array:2 [ "nombre" => "Ana" "apellidos" => "Bustamante" ] 5 => array:2 [ "nombre" => "Marc" "apellidos" => "Miravitlles" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S030028961300152X" "doi" => "10.1016/j.arbres.2013.05.004" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S030028961300152X?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001924?idApp=UINPBA00003Z" "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001924/v1_201312010030/en/main.assets" ] "en" => array:14 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Clinical Image</span>" "titulo" => "Pulmonary Artery Aneurysm" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "551" "paginaFinal" => "552" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Victoria Mayoral-Campos, José Luis de Benito-Arévalo, Marzo Antonio Varea-Sanz" "autores" => array:3 [ 0 => array:4 [ "nombre" => "Victoria" "apellidos" => "Mayoral-Campos" "email" => array:1 [ 0 => "vickymayoral@gmail.com" ] "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">¿</span>" "identificador" => "cor0005" ] ] ] 1 => array:2 [ "nombre" => "José Luis" "apellidos" => "de Benito-Arévalo" ] 2 => array:2 [ "nombre" => "Marzo Antonio" "apellidos" => "Varea-Sanz" ] ] "afiliaciones" => array:1 [ 0 => array:2 [ "entidad" => "Servicio de Radiología, Hospital Clínico Universitario Lozano Blesa, Zaragoza, Spain" "identificador" => "aff0005" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Aneurisma de la arteria pulmonar" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 716 "Ancho" => 3250 "Tamanyo" => 276617 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Chest X-ray, posterior–anterior (PA) (A) and lateral (B), in which a smooth rounded lesion at the level of the left hilum can be seen in the PA projection (arrows 1A), projecting into the retrosternal space (arrow 1B). Chest CT with the administration of intravenous contrast, sagittal and axial projection (C and D) confirms an aneurysmatic dilatation of the conus arteriosus.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><p id="par0005" class="elsevierStylePara elsevierViewall">We present the case of a 77-year-old patient with a history of hypertension and glaucoma, who was admitted to our hospital for symptoms of dyspnea at rest, with no cough or expectoration. As a casual finding on the chest radiograph (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>A and B), a saccular image was observed with well-defined borders at the level of the left hilum (arrows 1A), extending toward the retrosternal space (arrow 1B). It was decided to complete the study with chest-computed tomography (CT) with intravenous iodated contrast (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>C and D), in which an aneurysmatic dilatation of the conus arteriosus, 75<span class="elsevierStyleHsp" style=""></span>mm in diameter (<span class="elsevierStyleItalic">p</span>), was reported, with no other findings of interest. Due to the patient's clinical history (asymptomatic, located in the pulmonary trunk, with no data indicating a high risk of rupture), it was decided to opt for a conservative approach to the aneurysm.</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0010" class="elsevierStylePara elsevierViewall">Pulmonary artery aneurysms are rare entities<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> and are difficult to diagnose due to their low prevalence, as they often present with non-specific symptoms or even in asymptomatic patients.<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a> Only isolated cases have been documented in the world literature, and their management remains unclear.</p></span>" "pdfFichero" => "main.pdf" "tienePdf" => true "NotaPie" => array:1 [ 0 => array:2 [ "etiqueta" => "☆" "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Please cite this article as: Mayoral-Campos V, de Benito-Arévalo JL, Varea-Sanz MA. Aneurisma de la arteria pulmonar. Arch Bronconeumol. 2013;49:551–552.</p>" ] ] "multimedia" => array:1 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 716 "Ancho" => 3250 "Tamanyo" => 276617 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Chest X-ray, posterior–anterior (PA) (A) and lateral (B), in which a smooth rounded lesion at the level of the left hilum can be seen in the PA projection (arrows 1A), projecting into the retrosternal space (arrow 1B). Chest CT with the administration of intravenous contrast, sagittal and axial projection (C and D) confirms an aneurysmatic dilatation of the conus arteriosus.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:2 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Idiopathic pulmonary artery aneurysm" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "G. Orman" 1 => "T.S. Guvenc" 2 => "B. Balci" 3 => "M. Duymus" 4 => "T. Sevingil" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.athoracsur.2012.08.044" "Revista" => array:7 [ "tituloSerie" => "Ann Thorac Surg" "fecha" => "2013" "volumen" => "95" "paginaInicial" => "e33" "paginaFinal" => "e34" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23336912" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0022534709005448" "estado" => "S300" "issn" => "00225347" ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Idiopathic pulmonary artery aneurysm: report of a case and review of the literature" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.E. Tomás Labat" 1 => "S. Beltrán Beltrán" 2 => "S. Molina Naveros" 3 => "F. Navarro Botella" 4 => "D. Alvarez Soto" 5 => "E. Pérez Moro" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "An Med Interna" "fecha" => "2005" "volumen" => "22" "paginaInicial" => "329" "paginaFinal" => "331" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16288578" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001882/v1_201312010030/en/main.assets" "Apartado" => array:4 [ "identificador" => "21342" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Clinical Image" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/15792129/0000004900000012/v1_201312010030/S1579212913001882/v1_201312010030/en/main.pdf?idApp=UINPBA00003Z&text.app=https://archbronconeumol.org/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001882?idApp=UINPBA00003Z" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 November | 6 | 8 | 14 |
| 2024 October | 40 | 22 | 62 |
| 2024 September | 31 | 16 | 47 |
| 2024 August | 60 | 36 | 96 |
| 2024 July | 46 | 29 | 75 |
| 2024 June | 46 | 24 | 70 |
| 2024 May | 52 | 25 | 77 |
| 2024 April | 42 | 24 | 66 |
| 2024 March | 33 | 16 | 49 |
| 2024 February | 27 | 27 | 54 |
| 2023 March | 12 | 2 | 14 |
| 2023 February | 37 | 20 | 57 |
| 2023 January | 23 | 38 | 61 |
| 2022 December | 35 | 40 | 75 |
| 2022 November | 30 | 30 | 60 |
| 2022 October | 39 | 32 | 71 |
| 2022 September | 28 | 32 | 60 |
| 2022 August | 35 | 45 | 80 |
| 2022 July | 29 | 48 | 77 |
| 2022 June | 33 | 29 | 62 |
| 2022 May | 32 | 32 | 64 |
| 2022 April | 27 | 38 | 65 |
| 2022 March | 35 | 42 | 77 |
| 2022 February | 29 | 26 | 55 |
| 2022 January | 26 | 34 | 60 |
| 2021 December | 29 | 36 | 65 |
| 2021 November | 33 | 43 | 76 |
| 2021 October | 38 | 41 | 79 |
| 2021 September | 32 | 46 | 78 |
| 2021 August | 23 | 31 | 54 |
| 2021 July | 31 | 23 | 54 |
| 2021 June | 34 | 34 | 68 |
| 2021 May | 31 | 41 | 72 |
| 2021 April | 83 | 74 | 157 |
| 2021 March | 38 | 18 | 56 |
| 2021 February | 24 | 18 | 42 |
| 2021 January | 18 | 15 | 33 |
| 2020 December | 21 | 16 | 37 |
| 2020 November | 21 | 15 | 36 |
| 2020 October | 16 | 5 | 21 |
| 2020 September | 14 | 9 | 23 |
| 2020 August | 14 | 7 | 21 |
| 2020 July | 25 | 22 | 47 |
| 2020 June | 7 | 5 | 12 |
| 2020 May | 39 | 11 | 50 |
| 2020 April | 36 | 16 | 52 |
| 2020 March | 11 | 13 | 24 |
| 2020 February | 29 | 13 | 42 |
| 2020 January | 20 | 15 | 35 |
| 2019 December | 25 | 10 | 35 |
| 2019 November | 20 | 23 | 43 |
| 2019 October | 15 | 9 | 24 |
| 2019 September | 11 | 15 | 26 |
| 2019 August | 24 | 10 | 34 |
| 2019 July | 22 | 12 | 34 |
| 2019 June | 21 | 5 | 26 |
| 2019 May | 27 | 12 | 39 |
| 2019 April | 32 | 9 | 41 |
| 2019 March | 51 | 9 | 60 |
| 2019 February | 32 | 9 | 41 |
| 2019 January | 29 | 11 | 40 |
| 2018 December | 32 | 17 | 49 |
| 2018 November | 49 | 21 | 70 |
| 2018 October | 85 | 24 | 109 |
| 2018 September | 27 | 5 | 32 |
| 2018 May | 14 | 0 | 14 |
| 2018 April | 31 | 9 | 40 |
| 2018 March | 24 | 0 | 24 |
| 2018 February | 36 | 8 | 44 |
| 2018 January | 32 | 6 | 38 |
| 2017 December | 39 | 2 | 41 |
| 2017 November | 22 | 5 | 27 |
| 2017 October | 24 | 8 | 32 |
| 2017 September | 24 | 6 | 30 |
| 2017 August | 48 | 8 | 56 |
| 2017 July | 45 | 5 | 50 |
| 2017 June | 41 | 8 | 49 |
| 2017 May | 41 | 5 | 46 |
| 2017 April | 39 | 8 | 47 |
| 2017 March | 25 | 41 | 66 |
| 2017 February | 19 | 3 | 22 |
| 2017 January | 10 | 5 | 15 |
| 2016 December | 32 | 7 | 39 |
| 2016 November | 51 | 10 | 61 |
| 2016 October | 41 | 26 | 67 |
| 2016 September | 40 | 14 | 54 |
| 2016 August | 52 | 10 | 62 |
| 2016 July | 23 | 17 | 40 |
| 2016 March | 2 | 0 | 2 |
| 2016 February | 3 | 0 | 3 |
| 2015 December | 3 | 0 | 3 |
| 2015 October | 52 | 3 | 55 |
| 2015 September | 43 | 12 | 55 |
| 2015 August | 40 | 8 | 48 |
| 2015 July | 47 | 14 | 61 |
| 2015 June | 23 | 4 | 27 |
| 2015 May | 68 | 17 | 85 |
| 2015 April | 37 | 6 | 43 |
| 2015 March | 54 | 6 | 60 |
| 2015 February | 47 | 4 | 51 |
| 2015 January | 37 | 11 | 48 |
| 2014 December | 32 | 6 | 38 |
| 2014 November | 33 | 9 | 42 |
| 2014 October | 51 | 14 | 65 |
| 2014 September | 23 | 10 | 33 |
| 2014 August | 40 | 11 | 51 |
| 2014 July | 35 | 6 | 41 |
| 2014 June | 51 | 14 | 65 |
| 2014 May | 45 | 51 | 96 |
| 2014 April | 47 | 10 | 57 |
| 2014 March | 50 | 12 | 62 |
| 2014 January | 0 | 1 | 1 |
| 2013 December | 1 | 0 | 1 |
Show all
