Human promyelocytic leukemia cells (HL60), human hepatoma cells (HepG2) and human embryonic kidney cells (HEK293T) were grown in RPMI-1640 (HL60) or DMEM (HepG2 and HEK293T) (Sigma-Aldrich), respectively, both supplemented with 10% FBS (Hyclone), 1% penicillin/streptomycin (Lonza) and 0.5% fungizone (Hyclone). The cells were grown at 37°C in a humidified incubator with 5% CO2.

TargetScan (http://www.targetscan.org) has been used to investigate if SERPINA1 3′UTR has potential binding sites for miR-320 family. TargetScan predicts miRNA targets based on the conserved complementarity to the seed of the miRNA.29

To test how members of the miR-320 family might affect SERPINA1 gene expression, the following members, miR-320a-3p, miR-320b, miR-320c, miR-320d and miR-320e were overexpressed in HepG2 cells, and then SERPINA1 gene expression was measured by RT-qPCR. This HepG2 cell line was selected since they express high basal levels of SERPINA1. HepG2 cells were seeded at 5×105 cells per well in 6-well plates and after 24h, cells were transiently transfected with 40nM of miR-320a-3p, miR-320b, miR-320c, miR-320d and miR-320e mimic (Ambion) or a no-miRNA control, using Oligofectamine (Invitrogen). At 48h after transfection, the cells were collected for analysis of SERPINA1 gene expression.

In order to investigate whether miR-320c binds the 3′UTR region of SERPINA1 gene we performed luciferase reporter experiments. The 3′UTR of SERPINA1 was first amplified by PCR from the 10835 HapMan cell line and cloned into the pGL3 Control Vector (Promega), downstream to the firefly luciferase. The cloned PCR products were validated by sequencing. The luciferase experiments were performed in HEK293T cells which were co-transfected with the pGL3 plasmid containing the 3′UTR of SERPINA1 gene and with miR-320c. HEK293T cells were grown to 80% confluence in 96-well plates and transfected using Lipofectamine 2000 reagent (Invitrogen) with 100ng of the firefly luciferase-SERPINA1 3′UTR construct, 7.5ng of the control vector pRL-CMV, and 40nM of miR-320c mimic (Ambion) or a non-targeting control (Ambion). Firefly and Renilla luciferase activities were measured consecutively using the Dual-Glo luciferase Assay System (Promega) 48 and 72h after transfection. Experiments were performed in quadruplicate and normalization was achieved using Renilla luciferase activity.

This project was designed as an observational case-control study to explore and describe the relationship of miR-320 expression with different chronic lung diseases in a population of individuals with different AAT genotypes. It was approved by the ethics committee of Instituto de Salud Carlos III (Madrid, Spain), as well as local ethics committees when necessary.

A total of 98 individuals with different AAT genotypes, were recruited between 2015 and 2016 from the Pulmonology consultations of 11 hospitals in Spain participating in the Spanish Registry of patients with AATD (REDAAT).30 Written informed consent was obtained in advance from all patients. The clinical characteristics of these cases are summarized in Table 1. For the purpose of the study, patients were stratified based on different parameters. Three groups were established depending on AAT serum levels (<50mg/dl, 50–100mg/dl or >100mg/dl). In addition cases were divided in two groups by the presence of any respiratory disease (yes/no) and those with respiratory disease were sub classified according to their clinical diagnoses (as per their clinical records) into the following categories: Emphysema, Bronchiectasis, Chronic bronchitis and Asthma.

Regarding their lung disease severity and in order to avoid multiple subclassification in small groups those with respiratory disease were only divided as severe impairment (FEV1<50%) or non-severe (FEV1>50%). FEV1/FVC (<70% predicted) was considered as indicator of airways obstruction. Smoking status was recorded as never, current and former. Administration of AAT replacement therapy was collected only as yes/no. The healthy controls were principally selected among family members of the patients.

The blood samples used for miRNA expression analysis were collected in PaxGene tubes (PreAnalytiX) locally and transported to the main laboratory. RNA isolation was performed following manufacturer recommendations.

To analyze the levels of miR-320c directly in the blood cells of patients, total RNA from blood samples was extracted using miRNeasy Micro kit (Qiagen) that allows purification of total RNA including small RNAs. Quantification of miR-320c expression was performed by qPCR using miRCURY LNA™ Universal RT microRNA PCR system (Exiqon) according to the manufacturer's protocol. Briefly, 100ng of total RNA was reverse transcribed and the resultant cDNA was 10x diluted and amplified with specific LNA primers and SYBR Green Master Mix (Exiqon).

For SERPINA1 expression, 1μg of total RNA was reverse transcribed using Maxima First Strand cDNA synthesis kit (Thermo Scientific). The cDNA was 10× diluted and amplified using fluorescent-labeled probes TaqMan (Roche Universal Probe library, Roche), specific primers and TaqMan Universal PCR Master Mix (Applied Biosystems). Gene-specific primers were as follows: SERPINA1F:tgaggagagcaggaaaggac, SERPINA1R:ctcagccagggagacagg (probe 18); GUSB_F:cgccctgcctatctgtattc, GUSB_R:tccccacagggagtgtgtag (probe 57). All reactions were performed in triplicate and no-template controls were included in each run. For normalization, GUSB was used as reference gene for mRNA expression and SNORA66 for miRNA expression. Relative expression was calculated by using the comparative cycle threshold (ΔΔCt) method.

Since miR-320c might be related to inflammation in pulmonary disease, we performed in vitro experiments to check how the bacterial lipopolysaccharide LPS, a known factor mimicking many inflammatory effects of cytokines, affects miR-320c expression. We treated HL60 cells with the pro-inflammatory factor LPS and quantitatively analyzed the expression of miR-320c at different time points. HL60 cells were seeded at 5×105 cells per well in 6-well plates and treated with 100nM of LPS from Escherichia coli 0111:B4 (Sigma–Aldrich). At 24, 48 and 72h, the cells were collected for analysis of miRNA expression.

Data analysis was performed with SPSS and GraphPad Prism softwares. Data is represented as mean and standard deviation (SD). A Student's t-test or Mann–Whitney test were used to evaluate differences between two groups, either to compare a group of patients with control healthy group, or between two patient categories separately. p<0.05 was considered statistically significant.

A potential binding site of miR-320 family in the 3′UTR of SERPINA1 was predicted (Fig. 1a). Most of the members of miR-320 family share a similar sequence that is predicted to target SERPINA1 3′UTR at position 256–262. The expression in HepG2 cells of miR-320a-3p, miR-320b, miR-320c, miR-320d but not miR-320e led to an inhibition of SERPINA1 expression (38–68% reduction), as compared to the no-miRNA control (Fig. 1b). Since miR-320c was one of the miRNAs reducing more SERPINA1 expression and was expressed in blood samples, we selected this miRNA for further experiments.

Fig. 1.

Regulation of SERPINA1 expression by miR-320 family. (A) Schematic diagram showing the predicted binding site on SERPINA1 3′UTR of 5 members of miR-320 family. (B) Relative expression of SERPINA1 after 48h of transfection of miR-320a-3p, miR-320b, miR-320c, miR-320d and miR-320e mimics or no miRNA into HepG2 cells, expressed as percentage. (C) Relative luciferase activity of a reporter vector carrying the SERPINA1 3′UTR downstream of the firefly luciferase gene, expressed as percentage. The vector was co-transfected with miR-320c mimic, non-targeting control or with no miRNA into HEK293T cells. Luciferase activity was analyzed at 48 and 72h. Data represent the mean (± standard deviation, SD) of three independent experiments and are presented relative to mock transfection (no miR). *p<0.05, **p<0.005, ***p<0.001.

(0.2MB).

Experimental validation of the binding of miR-320c to the 3′UTR, showed marked reduction in luciferase levels (up to 70% at 72h) compared to those cells with no-miRNA transfection (Fig. 1c). These data demonstrate that miR-320c targets SERPINA1 3′UTR and inhibits SERPINA1 in HepG2 cells.

To investigate the potential of miR-320c as a disease biomarker in AATD, first we compared expression in 19 healthy non-deficient individuals (AAT>100mg/dl) being 12 MM, and in addition 7 healthy cases with genotypes MS (5 cases) and MZ (2 cases) without symptoms of disease, with 34 subjects with severe AAT deficiency (AAT<50mg/dl) and 25 individuals with intermediate AAT deficiency (AAT between 50 and 100mg/dl). A significant increase of miR-320c in AAT deficient individuals was observed (Fig. 2a). When miR-320c was analyzed in an additional group of 20 COPD non-deficient patients (AAT>100mg/dl), significantly higher levels comparing to healthy non-deficient individuals were observed, similar to the expression levels detected in AAT deficient subjects (Fig. 2a). When all subjects were stratified according to the presence or absence of lung disease, significant higher levels of miR-320c were detected in individuals with disease (Fig. 2b). Stratification of patients according to the type of airway disease revealed significantly higher miR-320c levels in all groups of patients (bronchiectasis, emphysema, chronic bronchitis and asthma) compared with the healthy individuals (Fig. 2c). In addition, when subjects were stratified according to the presence or absence of lung disease and AAT deficiency, the lowest expression of miR-320c was observed in the healthy non-deficient individuals, followed by the healthy deficient subjects and then the non-deficient individuals with pulmonary disease, and the higher levels were detected in the AAT deficient patients with pulmonary disease (Fig. 2d). Although not statistically significant, ZZ patients with pulmonary disease showed a trend to higher expression of miR-320c when compared with asymptomatic ZZ patients (Fig. 2e). Regarding alpha-1-antitrypsin augmentation therapy, the group of ZZ patients with pulmonary disease who were under treatment showed a trend to lower levels of miR-320c compared to those with pulmonary disease and not treated, although the decrease was not statistically significant (Fig. 2f). Finally, we did not find significant differences in miR-320c expression between non-smokers, smokers and former smokers (Fig. 2g, h). These data show that miR-320c is overexpressed in the blood of patients with lung disease.

Fig. 2.

Relative expression of miR-320c in the blood of 98 individuals with different levels of serum AAT. Statistical analysis of miR-320c expression was performed between (A) 34 subjects with AAT serum levels>50mg/dl, 25 subjects with AAT levels between 50 and 100mg/dl, 19 healthy non-deficient (AAT>100mg/dl) subjects and 20 COPD non-deficient (AAT>100mg/dl) patients; (B) 31 healthy individuals and 66 patients with pulmonary disease; (C) 31 healthy individuals, 19 patients with bronchiectasis, 40 with emphysema, 32 with chronic bronchitis and 13 with asthma; (D) 17 healthy subjects with AAT levels>100mg/dl, 14 healthy subjects with AAT levels<100mg/dl, 21 patients with pulmonary disease and AAT levels>100mg/dl and 45 patients with pulmonary disease and AAT levels<100mg/dl; (E) 5 ZZ asymtomatic patients and 21 ZZ patients with pulmonary disease; (F) 5 ZZ asymptomatic patients, 7 ZZ patients with pulmonary disease and not treated and 14 ZZ patients with pulmonary disease under augmentation therapy; (G) 27 never smokers, 26 current smokers and 41 former smokers; (H) 14 healthy never smokers, 13 never smokers with pulmonary disease, 14 healthy ever smokers and 52 ever smokers with pulmonary disease. Single values, mean and standard deviation of miR-320c expression are shown. * p<0.05. PD=pulmonary disease.

(0.27MB).

Treatment of HL-60 cells with pro-inflammatory factor LPS revealed an effect on miR-320c expression. After 48h of treatment with LPS, a significant increase in the levels of miR-320c was observed in comparison with the non-treated cells (Fig. 3). This increase was even higher at 72h after LPS treatment suggesting a sustained response.

Fig. 3.

LPS-induced expression of miR-320c in HL60 cells. Relative expression of miR-320c after 24, 48 and 72h of treatment with LPS. Data represent the mean (± SD) of three independent experiments. * p<0.05, ** p<0.005.

(0.04MB).