Statistics

 array:23 [
  "pii" => "S1579212921002007"
  "issn" => "15792129"
  "doi" => "10.1016/j.arbr.2020.03.031"
  "estado" => "S300"
  "fechaPublicacion" => "2021-07-01"
  "aid" => "2437"
  "copyright" => "SEPAR"
  "copyrightAnyo" => "2020"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "cita" => "Arch Bronconeumol. 2021;57:457-63"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S1579212921002019"
    "issn" => "15792129"
    "doi" => "10.1016/j.arbr.2020.03.032"
    "estado" => "S300"
    "fechaPublicacion" => "2021-07-01"
    "aid" => "2440"
    "copyright" => "SEPAR"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "cita" => "Arch Bronconeumol. 2021;57:464-70"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:14 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Do Saharan Dust Days Carry a Risk of Hospitalization From Respiratory Diseases for Citizens of the Canary Islands &#40;Spain&#41;&#63;"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:3 [
        0 => "en"
        1 => "en"
        2 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "464"
          "paginaFinal" => "470"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "&#191;Los d&#237;as de calima sahariana conllevan un riesgo de hospitalizaci&#243;n por enfermedades respiratorias para los ciudadanos de las Islas Canarias&#44; Espa&#241;a&#63;"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 1
        "multimedia" => array:5 [
          "identificador" => "fig0025"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => false
          "mostrarDisplay" => true
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "fx1.jpeg"
              "Alto" => 740
              "Ancho" => 1333
              "Tamanyo" => 124093
            ]
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Elena L&#243;pez-Villarrubia, Olga Costa Estirado, Carmen &#205;&#241;iguez Hern&#225;ndez, Ferran Ballester D&#237;ez"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "Elena"
              "apellidos" => "L&#243;pez-Villarrubia"
            ]
            1 => array:2 [
              "nombre" => "Olga"
              "apellidos" => "Costa Estirado"
            ]
            2 => array:2 [
              "nombre" => "Carmen"
              "apellidos" => "&#205;&#241;iguez Hern&#225;ndez"
            ]
            3 => array:2 [
              "nombre" => "Ferran"
              "apellidos" => "Ballester D&#237;ez"
            ]
          ]
        ]
      ]
      "resumen" => array:1 [
        0 => array:3 [
          "titulo" => "Graphical abstract"
          "clase" => "graphical"
          "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><elsevierMultimedia ident="fig0025"></elsevierMultimedia></p></span>"
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212921002019?idApp=UINPBA00003Z"
    "url" => "/15792129/0000005700000007/v1_202107020656/S1579212921002019/v1_202107020656/en/main.assets"
  ]
  "itemAnterior" => array:18 [
    "pii" => "S157921292100207X"
    "issn" => "15792129"
    "doi" => "10.1016/j.arbr.2021.01.005"
    "estado" => "S300"
    "fechaPublicacion" => "2021-07-01"
    "aid" => "2723"
    "copyright" => "SEPAR"
    "documento" => "simple-article"
    "crossmark" => 1
    "subdocumento" => "edi"
    "cita" => "Arch Bronconeumol. 2021;57:455-6"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:10 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Editorial</span>"
      "titulo" => "Morbidity Attributable to Second-Hand Smoke in European Children"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "455"
          "paginaFinal" => "456"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Morbilidad atribuible al tabaquismo pasivo en ni&#241;os europeos"
        ]
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Giuseppe Gorini, Giulia Carreras"
          "autores" => array:2 [
            0 => array:2 [
              "nombre" => "Giuseppe"
              "apellidos" => "Gorini"
            ]
            1 => array:2 [
              "nombre" => "Giulia"
              "apellidos" => "Carreras"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S157921292100207X?idApp=UINPBA00003Z"
    "url" => "/15792129/0000005700000007/v1_202107020656/S157921292100207X/v1_202107020656/en/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
    "titulo" => "miR-320c Regulates <span class="elsevierStyleItalic">SERPINA1</span> Expression and Is Induced in Patients With Pulmonary Disease"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "457"
        "paginaFinal" => "463"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Nerea Matamala, Beatriz Lara, Gema G&#243;mez-Mariano, Selene Mart&#237;nez, Irene V&#225;zquez-Dom&#237;nguez, &#193;lvaro Otero-Sobrino, Antonio Mu&#241;oz-Callejas, Elena S&#225;nchez, Cristina Esquinas, Ana Bustamante, Sergio Cadenas, Sergio Curi, Lourdes L&#225;zaro, Mar&#237;a Teresa Mart&#237;nez, Esther Rodr&#237;guez, Marc Miravitlles, Mar&#237;a Torres-Duran, In&#233;s Herrero, Francisco Javier Michel, Silvia Castillo, Jos&#233; M&#170; Hern&#225;ndez-P&#233;rez, Ignacio Blanco, Francisco Casas, Beatriz Mart&#237;nez-Delgado"
        "autores" => array:24 [
          0 => array:3 [
            "nombre" => "Nerea"
            "apellidos" => "Matamala"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Beatriz"
            "apellidos" => "Lara"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Gema"
            "apellidos" => "G&#243;mez-Mariano"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Selene"
            "apellidos" => "Mart&#237;nez"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Irene"
            "apellidos" => "V&#225;zquez-Dom&#237;nguez"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "&#193;lvaro"
            "apellidos" => "Otero-Sobrino"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Antonio"
            "apellidos" => "Mu&#241;oz-Callejas"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          7 => array:3 [
            "nombre" => "Elena"
            "apellidos" => "S&#225;nchez"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          8 => array:3 [
            "nombre" => "Cristina"
            "apellidos" => "Esquinas"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
            ]
          ]
          9 => array:3 [
            "nombre" => "Ana"
            "apellidos" => "Bustamante"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">f</span>"
                "identificador" => "aff0030"
              ]
            ]
          ]
          10 => array:3 [
            "nombre" => "Sergio"
            "apellidos" => "Cadenas"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">g</span>"
                "identificador" => "aff0035"
              ]
            ]
          ]
          11 => array:3 [
            "nombre" => "Sergio"
            "apellidos" => "Curi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">h</span>"
                "identificador" => "aff0040"
              ]
            ]
          ]
          12 => array:3 [
            "nombre" => "Lourdes"
            "apellidos" => "L&#225;zaro"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">i</span>"
                "identificador" => "aff0045"
              ]
            ]
          ]
          13 => array:3 [
            "nombre" => "Mar&#237;a Teresa"
            "apellidos" => "Mart&#237;nez"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">j</span>"
                "identificador" => "aff0050"
              ]
            ]
          ]
          14 => array:3 [
            "nombre" => "Esther"
            "apellidos" => "Rodr&#237;guez"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
            ]
          ]
          15 => array:3 [
            "nombre" => "Marc"
            "apellidos" => "Miravitlles"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
            ]
          ]
          16 => array:3 [
            "nombre" => "Mar&#237;a"
            "apellidos" => "Torres-Duran"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">k</span>"
                "identificador" => "aff0055"
              ]
            ]
          ]
          17 => array:3 [
            "nombre" => "In&#233;s"
            "apellidos" => "Herrero"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">l</span>"
                "identificador" => "aff0060"
              ]
            ]
          ]
          18 => array:3 [
            "nombre" => "Francisco Javier"
            "apellidos" => "Michel"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">m</span>"
                "identificador" => "aff0065"
              ]
            ]
          ]
          19 => array:3 [
            "nombre" => "Silvia"
            "apellidos" => "Castillo"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">n</span>"
                "identificador" => "aff0070"
              ]
            ]
          ]
          20 => array:3 [
            "nombre" => "Jos&#233; M&#170;"
            "apellidos" => "Hern&#225;ndez-P&#233;rez"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">o</span>"
                "identificador" => "aff0075"
              ]
            ]
          ]
          21 => array:3 [
            "nombre" => "Ignacio"
            "apellidos" => "Blanco"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          22 => array:3 [
            "nombre" => "Francisco"
            "apellidos" => "Casas"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">p</span>"
                "identificador" => "aff0080"
              ]
            ]
          ]
          23 => array:4 [
            "nombre" => "Beatriz"
            "apellidos" => "Mart&#237;nez-Delgado"
            "email" => array:1 [
              0 => "bmartinezd@isciii.es"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:16 [
          0 => array:3 [
            "entidad" => "Molecular Genetics Unit&#44; Instituto de Investigaci&#243;n de Enfermedades Raras &#40;IIER&#41;&#44; Instituto de Salud Carlos III &#40;ISCIII&#41;&#44; CIBER de Enfermedades Raras &#40;CIBERER&#41;&#44; Madrid&#44; Spain"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Respiratory Medicine Department&#44; Coventry University Hospital&#44; Coventry&#44; UK"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Centro de Biolog&#237;a Molecular Severo Ochoa &#40;CBMSO&#41;&#44; Consejo Superior de Investigaciones Cient&#237;ficas-Universidad Aut&#243;noma de Madrid &#40;CSIC-UAM&#41;&#44; Madrid&#44; Spain"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Registro Espa&#241;ol de pacientes con d&#233;ficit de alfa-1 antitripsina &#40;REDAAT&#41;&#44; Fundaci&#243;n Espa&#241;ola de Pulm&#243;n&#44; Respira&#44; SEPAR&#44; Barcelona&#44; Spain"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
          4 => array:3 [
            "entidad" => "Servicio de Neumolog&#237;a&#44; Hospital Universitari Vall d&#8217;Hebron&#47;Vall d&#8217;Hebron Institut de Recerca &#40;VHIR&#41;&#44; CIBER de Enfermedades Respiratorias &#40;CIBERES&#41;&#44; Barcelona&#44; Spain"
            "etiqueta" => "e"
            "identificador" => "aff0025"
          ]
          5 => array:3 [
            "entidad" => "Servicio de Neumolog&#237;a&#44; Hospital de Sierrallana&#44; Torrelavega&#44; Cantabria&#44; Spain"
            "etiqueta" => "f"
            "identificador" => "aff0030"
          ]
          6 => array:3 [
            "entidad" => "Servicio de Neumolog&#237;a&#44; Hospital Cl&#237;nico Universitario de Salamanca&#44; Spain"
            "etiqueta" => "g"
            "identificador" => "aff0035"
          ]
          7 => array:3 [
            "entidad" => "Complejo Hospitalario de Navarra&#44; Pamplona&#44; Spain"
            "etiqueta" => "h"
            "identificador" => "aff0040"
          ]
          8 => array:3 [
            "entidad" => "Servicio de Neumolog&#237;a&#44; Complejo Asistencial Universitario de Burgos&#44; Spain"
            "etiqueta" => "i"
            "identificador" => "aff0045"
          ]
          9 => array:3 [
            "entidad" => "Servicio de Neumolog&#237;a&#44; Hospital Universitario Doce de Octubre&#44; Madrid&#44; Spain"
            "etiqueta" => "j"
            "identificador" => "aff0050"
          ]
          10 => array:3 [
            "entidad" => "Servicio de Neumolog&#237;a&#44; Hospital &#193;lvaro Cunqueiro&#44; EOXI Vigo&#44; Pneumovigo I&#43;i&#44; IIS Galicia Sur&#44; Spain"
            "etiqueta" => "k"
            "identificador" => "aff0055"
          ]
          11 => array:3 [
            "entidad" => "Hospital Universitario Miguel Servet&#44; Zaragoza&#44; Spain"
            "etiqueta" => "l"
            "identificador" => "aff0060"
          ]
          12 => array:3 [
            "entidad" => "Servicio de Neumolog&#237;a&#44; Hospital Universitario Donostia&#44; Pa&#237;s Vasco&#44; Spain"
            "etiqueta" => "m"
            "identificador" => "aff0065"
          ]
          13 => array:3 [
            "entidad" => "Unidad de Neumolog&#237;a infantil y Fibrosis qu&#237;stica&#44; Hospital Cl&#237;nico Universitario de Valencia&#44; Spain"
            "etiqueta" => "n"
            "identificador" => "aff0070"
          ]
          14 => array:3 [
            "entidad" => "Servicio de Neumolog&#237;a&#44; Hospital General de la Palma&#44; Canarias&#44; Spain"
            "etiqueta" => "o"
            "identificador" => "aff0075"
          ]
          15 => array:3 [
            "entidad" => "Servicio de Neumolog&#237;a&#44; Hospital Universitario San Cecilio&#44; Granada&#44; Spain"
            "etiqueta" => "p"
            "identificador" => "aff0080"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "El miR-320c regula la expresi&#243;n del gen <span class="elsevierStyleItalic">SERPINA1</span> y se induce en pacientes con enfermedad pulmonar"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 1
      "multimedia" => array:5 [
        "identificador" => "fig0020"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "fx1.jpeg"
            "Alto" => 735
            "Ancho" => 1333
            "Tamanyo" => 65783
          ]
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Human alpha-1 antitrypsin &#40;AAT&#41; is one of the most important serine proteinase inhibitor primarily synthesized and secreted by hepatocytes&#46;<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">1</span></a> The protein exerts its major function in the lungs&#44; where it protects the alveolar tissue from proteolytic damage produced mainly by neutrophil elastase&#46;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">2</span></a> In addition to its role as antiprotease&#44; AAT has important anti-inflammatory and immunomodulatory properties&#46;<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">3</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">AAT is a polymorphic protein and small variations in its three-dimensional structure affect its susceptibility to polymerization and intracellular retention&#44; and also modify its anti-elastase capacity&#46;<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">4</span></a> Some authors have hypothesized that polymers can also cause inflammation by themselves&#46;<a class="elsevierStyleCrossRefs" href="#bib0235"><span class="elsevierStyleSup">5&#44;6</span></a> Accumulation and degradation of abnormal protein cause reduced AAT levels in the serum characteristic of the AAT deficiency &#40;AATD&#41;&#46; AATD is associated with chronic obstructive pulmonary disease &#40;COPD&#41; which mainly manifest as lung emphysema and occasionally&#44; neutrophilic panniculitis and systemic vasculitis&#46;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">7</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">The most common and physiologically normal allele is the M allele&#44; while Z &#40;Glu342Lys&#41; and S &#40;Glu264Val&#41; mutations are the most common deficiency variants&#46;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">8</span></a> Homozygous ZZ individuals present with severe AAT deficiency &#40;serum levels usually<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>57<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">9</span></a> Homozygous SS and composite heterozygous &#40;SZ&#41; have a mild and moderate deficiency &#40;range of serum levels measured by nephelometry in our laboratory&#58; 70&#8211;105 and 45&#8211;80<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#44; respectively&#41;&#46;<a class="elsevierStyleCrossRefs" href="#bib0260"><span class="elsevierStyleSup">10&#44;11</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">AAT deficiency &#40;AATD&#41; is not a disease in itself&#59; instead it is a genetic predisposition to develop lung or liver disease mainly in the presence of environmental factors such as inhaled toxins like tobacco smoke&#46; Even among deficient individuals with similar tobacco exposure&#44; high clinical heterogeneity has been observed&#44; ranging from asymptomatic to severe lung disease&#46;<a class="elsevierStyleCrossRefs" href="#bib0270"><span class="elsevierStyleSup">12&#8211;14</span></a> Then&#44; it is reasonable to hypothesize that additional genetic factors that influence gene expression may also be involved in disease presentation&#46;<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">15</span></a></p><p id="par0025" class="elsevierStylePara elsevierViewall">In recent years&#44; the role of different molecules participating in DNA transcription and RNA translation into proteins has become of interest to explain clinical variability in genetic conditions and also for their potential use as biomarkers&#46;<a class="elsevierStyleCrossRefs" href="#bib0290"><span class="elsevierStyleSup">16&#44;17</span></a> MicroRNAs &#40;miRNAs&#41; are small non-coding RNAs that play a crucial role in post transcriptional regulation&#46; Through the binding to the 3&#8242; untranslated region &#40;UTR&#41;&#44; miRNAs inhibit translation of target messenger RNAs &#40;mRNAs&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">18</span></a> miRNAs are involved in many biological processes and abnormal miRNA expression has been associated with various lung diseases such as COPD&#44; asthma and lung cancer&#46;<a class="elsevierStyleCrossRefs" href="#bib0305"><span class="elsevierStyleSup">19&#44;17</span></a> Because miRNAs are potent disease modifiers&#44;<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">20</span></a> miRNA deregulation could play an important role in the phenotypic heterogeneity of AATD&#46; In this context&#44; specific miRNAs could serve as biomarkers in the diagnosis&#44; prognosis and treatment of AATD&#46; Nevertheless&#44; the regulation of <span class="elsevierStyleItalic">SERPINA1</span> expression by miRNAs has been poorly investigated&#46; According to databases&#44; hundreds of miRNAs are predicted to target <span class="elsevierStyleItalic">SERPINA1</span> 3&#8242;UTR&#44; but only one&#44; miR-940&#44; has been experimentally validated so far&#46;<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">21</span></a> In addition&#44; few studies have explored the role of miRNAs in the pathogenesis of AATD&#46;<a class="elsevierStyleCrossRefs" href="#bib0305"><span class="elsevierStyleSup">19&#44;17&#44;22&#44;23</span></a></p><p id="par0030" class="elsevierStylePara elsevierViewall">The miR-320 family of miRNA has been associated with lung disease&#46;<a class="elsevierStyleCrossRefs" href="#bib0330"><span class="elsevierStyleSup">24&#8211;28</span></a> It comprises a group of 6 mature miRNAs encoded by sequences on chromosomes 8 &#40;miR-320a-5p and -3p&#41;&#44; 1 &#40;miR-320b&#41;&#44; 18 &#40;miR-320c&#41;&#44; 13 &#40;miR-320d&#41;&#44; X &#40;miR-320d&#41; and 19 &#40;miR-320e&#41; &#40;<a href="http://www.mirbase.org/">http&#58;&#47;&#47;www&#46;mirbase&#46;org&#47;</a>&#41;&#46; All of them&#44; except miR-320a-5p&#44; share the seed sequence and are predicted to target <span class="elsevierStyleItalic">SERPINA1</span> 3&#8242;UTR &#40;according to TargetScan database&#41;&#46;</p><p id="par0035" class="elsevierStylePara elsevierViewall">In the present study we aim to explore whether miR-320c&#44; as a representative member of miR-320 family&#44; could be implicated in AAT regulation and AATD pathogenesis&#44; contributing to explain clinical heterogeneity in the patients&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Growth and maintenance of cell lines</span><p id="par0040" class="elsevierStylePara elsevierViewall">Human promyelocytic leukemia cells &#40;HL60&#41;&#44; human hepatoma cells &#40;HepG2&#41; and human embryonic kidney cells &#40;HEK293T&#41; were grown in RPMI-1640 &#40;HL60&#41; or DMEM &#40;HepG2 and HEK293T&#41; &#40;Sigma-Aldrich&#41;&#44; respectively&#44; both supplemented with 10&#37; FBS &#40;Hyclone&#41;&#44; 1&#37; penicillin&#47;streptomycin &#40;Lonza&#41; and 0&#46;5&#37; fungizone &#40;Hyclone&#41;&#46; The cells were grown at 37<span class="elsevierStyleHsp" style=""></span>&#176;C in a humidified incubator with 5&#37; CO<span class="elsevierStyleInf">2</span>&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">miR-320 family in silico target prediction</span><p id="par0045" class="elsevierStylePara elsevierViewall">TargetScan &#40;<a href="http://www.targetscan.org/">http&#58;&#47;&#47;www&#46;targetscan&#46;org</a>&#41; has been used to investigate if <span class="elsevierStyleItalic">SERPINA1</span> 3&#8242;UTR has potential binding sites for miR-320 family&#46; TargetScan predicts miRNA targets based on the conserved complementarity to the seed of the miRNA&#46;<a class="elsevierStyleCrossRef" href="#bib0355"><span class="elsevierStyleSup">29</span></a></p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Exogenous miR-320 expression in HepG2 cells</span><p id="par0050" class="elsevierStylePara elsevierViewall">To test how members of the miR-320 family might affect <span class="elsevierStyleItalic">SERPINA1</span> gene expression&#44; the following members&#44; miR-320a-3p&#44; miR-320b&#44; miR-320c&#44; miR-320d and miR-320e were overexpressed in HepG2 cells&#44; and then <span class="elsevierStyleItalic">SERPINA1</span> gene expression was measured by RT-qPCR&#46; This HepG2 cell line was selected since they express high basal levels of <span class="elsevierStyleItalic">SERPINA1</span>&#46; HepG2 cells were seeded at 5<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">5</span> cells per well in 6-well plates and after 24<span class="elsevierStyleHsp" style=""></span>h&#44; cells were transiently transfected with 40<span class="elsevierStyleHsp" style=""></span>nM of miR-320a-3p&#44; miR-320b&#44; miR-320c&#44; miR-320d and miR-320e mimic &#40;Ambion&#41; or a no-miRNA control&#44; using Oligofectamine &#40;Invitrogen&#41;&#46; At 48<span class="elsevierStyleHsp" style=""></span>h after transfection&#44; the cells were collected for analysis of <span class="elsevierStyleItalic">SERPINA1</span> gene expression&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Regulation of <span class="elsevierStyleItalic">SERPINA1</span> gene by miR-320c through Luciferase reporter assays</span><p id="par0055" class="elsevierStylePara elsevierViewall">In order to investigate whether miR-320c binds the 3&#8242;UTR region of <span class="elsevierStyleItalic">SERPINA1</span> gene we performed luciferase reporter experiments&#46; The 3&#8242;UTR of <span class="elsevierStyleItalic">SERPINA1</span> was first amplified by PCR from the 10835 HapMan cell line and cloned into the pGL3 Control Vector &#40;Promega&#41;&#44; downstream to the firefly luciferase&#46; The cloned PCR products were validated by sequencing&#46; The luciferase experiments were performed in HEK293T cells which were co-transfected with the pGL3 plasmid containing the 3&#8242;UTR of <span class="elsevierStyleItalic">SERPINA1</span> gene and with miR-320c&#46; HEK293T cells were grown to 80&#37; confluence in 96-well plates and transfected using Lipofectamine 2000 reagent &#40;Invitrogen&#41; with 100<span class="elsevierStyleHsp" style=""></span>ng of the firefly luciferase-<span class="elsevierStyleItalic">SERPINA1</span> 3&#8242;UTR construct&#44; 7&#46;5<span class="elsevierStyleHsp" style=""></span>ng of the control vector pRL-CMV&#44; and 40<span class="elsevierStyleHsp" style=""></span>nM of miR-320c mimic &#40;Ambion&#41; or a non-targeting control &#40;Ambion&#41;&#46; Firefly and Renilla luciferase activities were measured consecutively using the Dual-Glo luciferase Assay System &#40;Promega&#41; 48 and 72<span class="elsevierStyleHsp" style=""></span>h after transfection&#46; Experiments were performed in quadruplicate and normalization was achieved using Renilla luciferase activity&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Gene and miRNA expression analysis by quantitative real time PCR &#40;qPCR&#41; in patients</span><p id="par0060" class="elsevierStylePara elsevierViewall">This project was designed as an observational case-control study to explore and describe the relationship of miR-320 expression with different chronic lung diseases in a population of individuals with different AAT genotypes&#46; It was approved by the ethics committee of Instituto de Salud Carlos III &#40;Madrid&#44; Spain&#41;&#44; as well as local ethics committees when necessary&#46;</p><p id="par0065" class="elsevierStylePara elsevierViewall">A total of 98 individuals with different AAT genotypes&#44; were recruited between 2015 and 2016 from the Pulmonology consultations of 11 hospitals in Spain participating in the Spanish Registry of patients with AATD &#40;REDAAT&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0360"><span class="elsevierStyleSup">30</span></a> Written informed consent was obtained in advance from all patients&#46; The clinical characteristics of these cases are summarized in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46; For the purpose of the study&#44; patients were stratified based on different parameters&#46; Three groups were established depending on AAT serum levels &#40;&#60;50<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#44; 50&#8211;100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl or &#62;100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#41;&#46; In addition cases were divided in two groups by the presence of any respiratory disease &#40;yes&#47;no&#41; and those with respiratory disease were sub classified according to their clinical diagnoses &#40;as per their clinical records&#41; into the following categories&#58; Emphysema&#44; Bronchiectasis&#44; Chronic bronchitis and Asthma&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0070" class="elsevierStylePara elsevierViewall">Regarding their lung disease severity and in order to avoid multiple subclassification in small groups those with respiratory disease were only divided as severe impairment &#40;FEV1<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>50&#37;&#41; or non-severe &#40;FEV1<span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>50&#37;&#41;&#46; FEV1&#47;FVC &#40;&#60;70&#37; predicted&#41; was considered as indicator of airways obstruction&#46; Smoking status was recorded as never&#44; current and former&#46; Administration of AAT replacement therapy was collected only as yes&#47;no&#46; The healthy controls were principally selected among family members of the patients&#46;</p><p id="par0075" class="elsevierStylePara elsevierViewall">The blood samples used for miRNA expression analysis were collected in PaxGene tubes &#40;PreAnalytiX&#41; locally and transported to the main laboratory&#46; RNA isolation was performed following manufacturer recommendations&#46;</p><p id="par0080" class="elsevierStylePara elsevierViewall">To analyze the levels of miR-320c directly in the blood cells of patients&#44; total RNA from blood samples was extracted using miRNeasy Micro kit &#40;Qiagen&#41; that allows purification of total RNA including small RNAs&#46; Quantification of miR-320c expression was performed by qPCR using miRCURY LNA&#8482; Universal RT microRNA PCR system &#40;Exiqon&#41; according to the manufacturer&#39;s protocol&#46; Briefly&#44; 100<span class="elsevierStyleHsp" style=""></span>ng of total RNA was reverse transcribed and the resultant cDNA was 10x diluted and amplified with specific LNA primers and SYBR Green Master Mix &#40;Exiqon&#41;&#46;</p><p id="par0085" class="elsevierStylePara elsevierViewall">For <span class="elsevierStyleItalic">SERPINA1</span> expression&#44; 1<span class="elsevierStyleHsp" style=""></span>&#956;g of total RNA was reverse transcribed using Maxima First Strand cDNA synthesis kit &#40;Thermo Scientific&#41;&#46; The cDNA was 10&#215; diluted and amplified using fluorescent-labeled probes TaqMan &#40;Roche Universal Probe library&#44; Roche&#41;&#44; specific primers and TaqMan Universal PCR Master Mix &#40;Applied Biosystems&#41;&#46; Gene-specific primers were as follows&#58; SERPINA1F&#58;tgaggagagcaggaaaggac&#44; SERPINA1R&#58;ctcagccagggagacagg &#40;probe 18&#41;&#59; GUSB&#95;F&#58;cgccctgcctatctgtattc&#44; GUSB&#95;R&#58;tccccacagggagtgtgtag &#40;probe 57&#41;&#46; All reactions were performed in triplicate and no-template controls were included in each run&#46; For normalization&#44; GUSB was used as reference gene for mRNA expression and SNORA66 for miRNA expression&#46; Relative expression was calculated by using the comparative cycle threshold &#40;&#916;&#916;Ct&#41; method&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Pro-inflammatory lipopolysaccharide &#40;LPS&#41; treatment of HL60 cells</span><p id="par0090" class="elsevierStylePara elsevierViewall">Since miR-320c might be related to inflammation in pulmonary disease&#44; we performed in vitro experiments to check how the bacterial lipopolysaccharide LPS&#44; a known factor mimicking many inflammatory effects of cytokines&#44; affects miR-320c expression&#46; We treated HL60 cells with the pro-inflammatory factor LPS and quantitatively analyzed the expression of miR-320c at different time points&#46; HL60 cells were seeded at 5<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>10<span class="elsevierStyleSup">5</span> cells per well in 6-well plates and treated with 100<span class="elsevierStyleHsp" style=""></span>nM of LPS from Escherichia coli 0111&#58;B4 &#40;Sigma&#8211;Aldrich&#41;&#46; At 24&#44; 48 and 72<span class="elsevierStyleHsp" style=""></span>h&#44; the cells were collected for analysis of miRNA expression&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Statistical analysis</span><p id="par0095" class="elsevierStylePara elsevierViewall">Data analysis was performed with SPSS and GraphPad Prism softwares&#46; Data is represented as mean and standard deviation &#40;SD&#41;&#46; A Student&#39;s <span class="elsevierStyleItalic">t</span>-test or Mann&#8211;Whitney test were used to evaluate differences between two groups&#44; either to compare a group of patients with control healthy group&#44; or between two patient categories separately&#46; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 was considered statistically significant&#46;</p></span></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Results</span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">miR-320c inhibits <span class="elsevierStyleItalic">SERPINA1</span> in HepG2 cells</span><p id="par0100" class="elsevierStylePara elsevierViewall">A potential binding site of miR-320 family in the 3&#8242;UTR of <span class="elsevierStyleItalic">SERPINA1</span> was predicted &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>a&#41;&#46; Most of the members of miR-320 family share a similar sequence that is predicted to target <span class="elsevierStyleItalic">SERPINA1</span> 3&#8242;UTR at position 256&#8211;262&#46; The expression in HepG2 cells of miR-320a-3p&#44; miR-320b&#44; miR-320c&#44; miR-320d but not miR-320e led to an inhibition of <span class="elsevierStyleItalic">SERPINA1</span> expression &#40;38&#8211;68&#37; reduction&#41;&#44; as compared to the no-miRNA control &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>b&#41;&#46; Since miR-320c was one of the miRNAs reducing more <span class="elsevierStyleItalic">SERPINA1</span> expression and was expressed in blood samples&#44; we selected this miRNA for further experiments&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0105" class="elsevierStylePara elsevierViewall">Experimental validation of the binding of miR-320c to the 3&#8242;UTR&#44; showed marked reduction in luciferase levels &#40;up to 70&#37; at 72<span class="elsevierStyleHsp" style=""></span>h&#41; compared to those cells with no-miRNA transfection &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>c&#41;&#46; These data demonstrate that miR-320c targets <span class="elsevierStyleItalic">SERPINA1</span> 3&#8242;UTR and inhibits <span class="elsevierStyleItalic">SERPINA1</span> in HepG2 cells&#46;</p></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">miR-320c is overexpressed in the blood of patients with lung disease</span><p id="par0110" class="elsevierStylePara elsevierViewall">To investigate the potential of miR-320c as a disease biomarker in AATD&#44; first we compared expression in 19 healthy non-deficient individuals &#40;AAT<span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#41; being 12 MM&#44; and in addition 7 healthy cases with genotypes MS &#40;5 cases&#41; and MZ &#40;2 cases&#41; without symptoms of disease&#44; with 34 subjects with severe AAT deficiency &#40;AAT<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>50<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#41; and 25 individuals with intermediate AAT deficiency &#40;AAT between 50 and 100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#41;&#46; A significant increase of miR-320c in AAT deficient individuals was observed &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>a&#41;&#46; When miR-320c was analyzed in an additional group of 20 COPD non-deficient patients &#40;AAT<span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#41;&#44; significantly higher levels comparing to healthy non-deficient individuals were observed&#44; similar to the expression levels detected in AAT deficient subjects &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>a&#41;&#46; When all subjects were stratified according to the presence or absence of lung disease&#44; significant higher levels of miR-320c were detected in individuals with disease &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>b&#41;&#46; Stratification of patients according to the type of airway disease revealed significantly higher miR-320c levels in all groups of patients &#40;bronchiectasis&#44; emphysema&#44; chronic bronchitis and asthma&#41; compared with the healthy individuals &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>c&#41;&#46; In addition&#44; when subjects were stratified according to the presence or absence of lung disease and AAT deficiency&#44; the lowest expression of miR-320c was observed in the healthy non-deficient individuals&#44; followed by the healthy deficient subjects and then the non-deficient individuals with pulmonary disease&#44; and the higher levels were detected in the AAT deficient patients with pulmonary disease &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>d&#41;&#46; Although not statistically significant&#44; ZZ patients with pulmonary disease showed a trend to higher expression of miR-320c when compared with asymptomatic ZZ patients &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>e&#41;&#46; Regarding alpha-1-antitrypsin augmentation therapy&#44; the group of ZZ patients with pulmonary disease who were under treatment showed a trend to lower levels of miR-320c compared to those with pulmonary disease and not treated&#44; although the decrease was not statistically significant &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>f&#41;&#46; Finally&#44; we did not find significant differences in miR-320c expression between non-smokers&#44; smokers and former smokers &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>g&#44; h&#41;&#46; These data show that miR-320c is overexpressed in the blood of patients with lung disease&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">miR-320c is overexpressed in LPS-treated HL60 cells</span><p id="par0115" class="elsevierStylePara elsevierViewall">Treatment of HL-60 cells with pro-inflammatory factor LPS revealed an effect on miR-320c expression&#46; After 48<span class="elsevierStyleHsp" style=""></span>h of treatment with LPS&#44; a significant increase in the levels of miR-320c was observed in comparison with the non-treated cells &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>&#41;&#46; This increase was even higher at 72<span class="elsevierStyleHsp" style=""></span>h after LPS treatment suggesting a sustained response&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia></span></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Discussion</span><p id="par0120" class="elsevierStylePara elsevierViewall">The role of specific miRNAs in the pulmonary disease associated with AAT deficiency is largely unknown&#46; Our results regarding miR-320c indicate&#44; first&#44; that this miRNA regulates <span class="elsevierStyleItalic">SERPINA1</span> expression at least in an hepatic cell line HepG2&#44; and second&#44; that it is overexpressed in the blood of both AATD patients with pulmonary disease and also non-deficient COPD patients&#44; likely because miR-320c might be modulated by inflammatory processes occurring in the disease&#46;</p><p id="par0125" class="elsevierStylePara elsevierViewall">Overexpression experiments in HepG2 cells led us to demonstrate that most of the members of miR-320 family decrease <span class="elsevierStyleItalic">SERPINA1</span> expression in vitro&#46; Given that miR-320a-3p&#44; miR-320b&#44; miR-320c&#44; miR-320d and miR-320e have the same seed sequence&#44; a similar miRNA-mRNA interaction was expected&#46; The only one that did not inhibit <span class="elsevierStyleItalic">SERPINA1</span> levels was miR-320e&#44; which presents an A instead of a G in the 3&#8242; region&#46; These results demonstrate that 3&#8242; compensatory sites might play an important role in target specificity&#44;<a class="elsevierStyleCrossRef" href="#bib0365"><span class="elsevierStyleSup">31</span></a> and targeting by each specific miRNA must be experimentally confirmed&#46;</p><p id="par0130" class="elsevierStylePara elsevierViewall">Identification of miRNAs regulating AAT expression is of great relevance&#46; It has been suggested that they could serve as a therapeutic strategy by decreasing the expression of mutant isoforms of the protein&#46; Mueller and coworkers<a class="elsevierStyleCrossRef" href="#bib0370"><span class="elsevierStyleSup">32</span></a> treated Z-AAT transgenic mice with a dual-function vector encoding for artificial miRNAs derived from miR-155 and for M-AAT resistant to these miRNAs&#46; As a result&#44; misfolded Z-AAT and liver inflammation were reduced and serum M-AAT was increased&#46; Similarly&#44; Eggenschwiler and collaborators<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">33</span></a> treated hepatic cells differentiated from patient-specific iPSCs with miR30-styled shRNA and observed a reduction of the polymeric AAT&#46;</p><p id="par0135" class="elsevierStylePara elsevierViewall">Importantly&#44; since miRNAs are easily detectable in blood samples&#44; they hold good promise as diagnostic biomarkers&#46;<a class="elsevierStyleCrossRefs" href="#bib0380"><span class="elsevierStyleSup">34&#8211;37</span></a> We identified significantly increased levels of miR-320c in the blood of patients with pulmonary disease not only associated with the deficiency&#44; as we also found increased levels of this miRNA in COPD patients with normal AAT levels&#46; The increase of miR-320c was observed independently of the type of airway disease &#40;bronchiectasis&#44; emphysema&#44; chronic bronchitis or asthma&#41;&#46; These results suggest a potential role of miR-320c as biomarker in lung disease&#46; The analysis of miR-320c in an extended group of patients with different types and degrees of lung disease would be interesting to further confirm these data&#46;</p><p id="par0140" class="elsevierStylePara elsevierViewall">Although we have demonstrated that miR-320c regulates <span class="elsevierStyleItalic">SERPINA1</span> expression in a hepatic cell line&#44; its role in whole blood could be different being more related to inflammation and lung tissue damage&#46; Expression analysis of miR-320c was performed on whole blood&#44; where different types of cells are present and macrophages and monocytes&#44; the main AAT producers&#44; represent a small percentage of them&#46; The use of purified monocytes and macrophages for future expression analysis would probably give a more clear association between miR-320c expression and AAT serum levels&#46; Nevertheless&#44; to be used as a biomarker of disease&#44; the analysis in whole blood could be more appropriate for a practical application&#46;</p><p id="par0145" class="elsevierStylePara elsevierViewall">It is probable that during pulmonary disease&#44; inflammatory signals lead to increase levels of miR-320c in blood as we have demonstrated in vitro after myeloid cell exposure to LPS&#46; According to our results&#44; expression of miR-320c might be stimulated by inflammatory processes&#46; A number of studies have shown that AAT has significant anti-inflammatory properties and AAT augmentation therapy reduces different inflammatory responses&#46;<a class="elsevierStyleCrossRefs" href="#bib0400"><span class="elsevierStyleSup">38&#8211;41</span></a> Although not significant&#44; a tendency of miR-320c levels to decrease in a small group receiving AAT therapy was observed&#46; The decrease in miR-320c expression in ZZ patients receiving AAT could be caused by these anti-inflammatory properties of AAT&#46; For example&#44; Hassan and collaborators<a class="elsevierStyleCrossRef" href="#bib0420"><span class="elsevierStyleSup">42</span></a> demonstrated that AAT decreases miR-199a&#44; miR-598 and miR-320a expression in ZZ monocytes through the inhibition of NF&#954;B&#46; The link between AAT augmentation therapy and miRNA expression alteration must be further investigated&#46;</p><p id="par0150" class="elsevierStylePara elsevierViewall">In conclusion&#44; we have demonstrated that most members of miR-320 family &#40;miR-320a-3p&#44; miR-320b&#44; miR-320c and miR-320d&#41; inhibit <span class="elsevierStyleItalic">SERPINA1</span> expression in vitro&#46; miR-320c targets <span class="elsevierStyleItalic">SERPINA1</span> 3&#8242;UTR and therefore may contribute to decrease levels of AAT&#46; Furthermore miR-320c was found overexpressed in the blood of patients with pulmonary disease&#44; likely as a result of inflammatory signals&#46; Although the link between miR-320c and lung damage should be further investigated&#44; these results suggest that miR-320c could be a biomarker of inflammatory processes in pulmonary diseases&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Funding</span><p id="par0155" class="elsevierStylePara elsevierViewall">This study was financed by grants from the <span class="elsevierStyleGrantSponsor" id="gs1">Institute of Health Carlos III</span> &#40;<span class="elsevierStyleGrantNumber" refid="gs1">AESI PI14CIII&#47;00070</span> and <span class="elsevierStyleGrantNumber" refid="gs1">PI17CIII&#47;00042</span>&#41; and <span class="elsevierStyleGrantSponsor" id="gs2">SEPAR</span> &#40;Sociedad Espa&#241;ola de Neumolog&#237;a y Cirug&#237;a Tor&#225;cica&#41;&#44; project <span class="elsevierStyleGrantNumber" refid="gs2">92&#47;2014</span>&#46;</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Conflicts of interest</span><p id="par0160" class="elsevierStylePara elsevierViewall">N&#46; Matamala&#44; G&#46; G&#243;mez-Mariano&#44; S&#46; Mart&#237;nez&#44; I&#46; V&#225;zquez-Dom&#237;nguez&#44; &#193;&#46; Otero-Sobrino&#44; A&#46; Mu&#241;oz-Callejas&#44; E&#46; S&#225;nchez&#44; C&#46; Esquinas&#44; A&#46; Bustamante&#44; S&#46; Cadenas&#44; S&#46; Curi&#44; M&#46;T&#46; Mart&#237;nez&#44; E&#46; Rodr&#237;guez&#44; I&#46; Herrero&#44; S&#46; Castillo&#44; J&#46;M&#46; Hern&#225;ndez&#44; I&#46; Blanco&#44; F&#46; Casas&#44; B&#46; Mart&#237;nez-Delgado&#58; have nothing to disclose&#46;</p><p id="par0165" class="elsevierStylePara elsevierViewall">B&#46; Lara&#58; personal fees from Oracle Fieldwork&#46;</p><p id="par0170" class="elsevierStylePara elsevierViewall">F&#46;J&#46; Michel&#58; personal fees from CSL Behring&#44; non-financial support from GrifolsandCSL Behring&#46;</p><p id="par0175" class="elsevierStylePara elsevierViewall">L&#46; Lazaro&#58; non-financial support from Grifols Movaco SA&#44; and CSL Behring&#46;</p><p id="par0180" class="elsevierStylePara elsevierViewall">M&#46; Torres-Dur&#225;n&#58; personal fees from Grifols and CSL Behring&#46;</p><p id="par0185" class="elsevierStylePara elsevierViewall">M&#46; Miravitlles&#58; personal fees from AstraZeneca&#44; Boehringer Ingelheim&#44; Chiesi&#44; Cipla&#44; Menarini&#44; Rovi&#44; Bial&#44; Zambon&#44; CSL Behring&#44; Grifols and Novartis&#44; personal fees from AstraZeneca&#44; Boehringer Ingelheim&#44; Chiesi&#44; GlaxoSmithKline&#44; Bial&#44; Gebro Pharma&#44; CSL Behring&#44; Laboratorios Esteve&#44; Mereo Biopharma&#44; Verona Pharma&#44; TEVA&#44; pH Pharma&#44; Novartis and Grifols&#44; grants from GlaxoSmithKline and Grifols&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:13 [
        0 => array:3 [
          "identificador" => "xres1542032"
          "titulo" => "Graphical abstract"
          "secciones" => array:1 [
            0 => array:1 [
              "identificador" => "abst0005"
            ]
          ]
        ]
        1 => array:3 [
          "identificador" => "xres1542033"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Introduction"
            ]
            1 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Methods"
            ]
            2 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        2 => array:2 [
          "identificador" => "xpalclavsec1394988"
          "titulo" => "Keywords"
        ]
        3 => array:3 [
          "identificador" => "xres1542034"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Introducci&#243;n"
            ]
            1 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "M&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "abst0045"
              "titulo" => "Conclusi&#243;n"
            ]
          ]
        ]
        4 => array:2 [
          "identificador" => "xpalclavsec1394987"
          "titulo" => "Palabras clave"
        ]
        5 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        6 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:7 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Growth and maintenance of cell lines"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "miR-320 family in silico target prediction"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Exogenous miR-320 expression in HepG2 cells"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Regulation of SERPINA1 gene by miR-320c through Luciferase reporter assays"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Gene and miRNA expression analysis by quantitative real time PCR &#40;qPCR&#41; in patients"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Pro-inflammatory lipopolysaccharide &#40;LPS&#41; treatment of HL60 cells"
            ]
            6 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        7 => array:3 [
          "identificador" => "sec0050"
          "titulo" => "Results"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "miR-320c inhibits SERPINA1 in HepG2 cells"
            ]
            1 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "miR-320c is overexpressed in the blood of patients with lung disease"
            ]
            2 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "miR-320c is overexpressed in LPS-treated HL60 cells"
            ]
          ]
        ]
        8 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Discussion"
        ]
        9 => array:2 [
          "identificador" => "sec0075"
          "titulo" => "Funding"
        ]
        10 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Conflicts of interest"
        ]
        11 => array:2 [
          "identificador" => "xack543143"
          "titulo" => "Acknowledgments"
        ]
        12 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2019-08-29"
    "fechaAceptado" => "2020-03-11"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1394988"
          "palabras" => array:5 [
            0 => "microRNA"
            1 => "miR-320c"
            2 => "Alpha-1 antitrypsin deficiency"
            3 => "Lung disease"
            4 => "Inflammation"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1394987"
          "palabras" => array:5 [
            0 => "microARNs"
            1 => "miR-320c"
            2 => "D&#233;ficit de alfa-1 antitripsina"
            3 => "Enfermedad pulmonar"
            4 => "Inflamaci&#243;n"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Introduction</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Alpha-1 antitrypsin deficiency &#40;AATD&#41; is a genetic condition resulting in lung and liver disease with a great clinical variability&#46; MicroRNAs have been identified as disease modifiers&#59; therefore miRNA deregulation could play an important role in disease heterogeneity&#46; Members of miR-320 family are involved in regulating of multiple processes including inflammation&#44; and have potential specific binding sites in the 3&#8242;UTR region of <span class="elsevierStyleItalic">SERPINA1</span> gene&#46; In this study we explore the involvement of miR-320c&#44; a member of this family&#44; in this disease&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Methods</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Firstly in vitro studies were carried out to demonstrate regulation of <span class="elsevierStyleItalic">SERPINA1</span> gene by miR-320&#46; Furthermore&#44; the expression of miR-320c was analyzed in the blood of 98 individuals with different AAT serum levels by using quantitative PCR and expression was correlated to clinical parameters of the patients&#46; Finally&#44; HL60 cells were used to analyze induction of miR-320c in inflammatory conditions&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Results</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Overexpression of miR-320 members in human HepG2 cells led to inhibition of <span class="elsevierStyleItalic">SERPINA1</span> expression&#46; Analysis of miR-320c expression in patient&#39;s samples revealed significantly increased expression of miR-320c in individuals with pulmonary disease&#46; Additionally&#44; HL60 cells treated with the pro-inflammatory factor lipopolysaccharide &#40;LPS&#41; showed increase in miR-320c expression&#44; suggesting that miR-320c responds to inflammation&#46;</p></span> <span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Conclusion</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Our findings demonstrate that miR-320c inhibits <span class="elsevierStyleItalic">SERPINA1</span> expression in a hepatic cell line and its levels in blood are associated with lung disease in a cohort of patients with different AAT serum levels&#46; These results suggest that miR-320c can play a role in AAT regulation and could be a biomarker of inflammatory processes in pulmonary diseases&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Introduction"
          ]
          1 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Methods"
          ]
          2 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Conclusion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Introducci&#243;n</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">La deficiencia de alfa-1 antitripsina &#40;DAAT&#41; es una condici&#243;n gen&#233;tica que produce enfermedad pulmonar y hep&#225;tica con una gran variabilidad cl&#237;nica&#46; Los microARN se han identificado como modificadores de la gravedad de algunas enfermedades y su desregulaci&#243;n podr&#237;a desempe&#241;ar un papel en la heterogeneidad de esta enfermedad&#46; Los miembros de la familia miR-320 regulan m&#250;ltiples procesos&#44; incluyendo la inflamaci&#243;n&#44; y tienen lugares de uni&#243;n en la regi&#243;n 3&#8217;UTR del gen <span class="elsevierStyleItalic">SERPINA1</span>&#46; En este estudio exploramos la implicaci&#243;n del miR-320c&#44; un miembro de esta familia&#44; en la DAAT&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">M&#233;todos</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Primero se realizaron estudios in vitro para demostrar la regulaci&#243;n del gen <span class="elsevierStyleItalic">SERPINA1</span> por parte del miR-320&#46; Adem&#225;s&#44; se analiz&#243; la expresi&#243;n de miR-320c en la sangre de 98 individuos con diferentes niveles de AAT mediante PCR cuantitativa y se correlacion&#243; con los par&#225;metros cl&#237;nicos&#46; Por &#250;ltimo&#44; se utilizaron c&#233;lulas HL60 para analizar la inducci&#243;n de miR-320c en condiciones inflamatorias&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Resultados</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">La sobreexpresi&#243;n del miR-320 en c&#233;lulas HepG2 inhib&#237;a la expresi&#243;n del gen <span class="elsevierStyleItalic">SERPINA1</span>&#46; El an&#225;lisis de expresi&#243;n de miR-320c en los pacientes revel&#243; una expresi&#243;n significativamente aumentada en los casos con enfermedad pulmonar&#46; Por otro lado&#44; las c&#233;lulas HL60 tratadas con LPS como factor proinflamatorio mostraron un aumento de expresi&#243;n de miR-320c&#44; lo que sugiere que este miARN responde a procesos inflamatorios&#46;</p></span> <span id="abst0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Conclusi&#243;n</span><p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Nuestros resultados demuestran que el miR-320c inhibe la expresi&#243;n de <span class="elsevierStyleItalic">SERPINA1</span> en c&#233;lulas hep&#225;ticas y que sus niveles en sangre est&#225;n asociados con la presencia de enfermedad pulmonar en pacientes con diferentes niveles de AAT&#46; Esto sugiere que el miR-320c desempe&#241;a un papel en la regulaci&#243;n de los niveles de AAT y podr&#237;a ser un biomarcador de inflamaci&#243;n en enfermedades pulmonares&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Introducci&#243;n"
          ]
          1 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "M&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "abst0045"
            "titulo" => "Conclusi&#243;n"
          ]
        ]
      ]
    ]
    "multimedia" => array:5 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 2399
            "Ancho" => 1667
            "Tamanyo" => 211470
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Regulation of <span class="elsevierStyleItalic">SERPINA1</span> expression by miR-320 family&#46; &#40;A&#41; Schematic diagram showing the predicted binding site on <span class="elsevierStyleItalic">SERPINA1</span> 3&#8242;UTR of 5 members of miR-320 family&#46; &#40;B&#41; Relative expression of <span class="elsevierStyleItalic">SERPINA1</span> after 48<span class="elsevierStyleHsp" style=""></span>h of transfection of miR-320a-3p&#44; miR-320b&#44; miR-320c&#44; miR-320d and miR-320e mimics or no miRNA into HepG2 cells&#44; expressed as percentage&#46; &#40;C&#41; Relative luciferase activity of a reporter vector carrying the <span class="elsevierStyleItalic">SERPINA1</span> 3&#8242;UTR downstream of the firefly luciferase gene&#44; expressed as percentage&#46; The vector was co-transfected with miR-320c mimic&#44; non-targeting control or with no miRNA into HEK293T cells&#46; Luciferase activity was analyzed at 48 and 72<span class="elsevierStyleHsp" style=""></span>h&#46; Data represent the mean &#40;&#177; standard deviation&#44; SD&#41; of three independent experiments and are presented relative to mock transfection &#40;no miR&#41;&#46; &#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; &#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;005&#44; &#42;&#42;&#42;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;001&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 2620
            "Ancho" => 1500
            "Tamanyo" => 280643
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Relative expression of miR-320c in the blood of 98 individuals with different levels of serum AAT&#46; Statistical analysis of miR-320c expression was performed between &#40;A&#41; 34 subjects with AAT serum levels<span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>50<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#44; 25 subjects with AAT levels between 50 and 100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#44; 19 healthy non-deficient &#40;AAT<span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#41; subjects and 20 COPD non-deficient &#40;AAT<span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#41; patients&#59; &#40;B&#41; 31 healthy individuals and 66 patients with pulmonary disease&#59; &#40;C&#41; 31 healthy individuals&#44; 19 patients with bronchiectasis&#44; 40 with emphysema&#44; 32 with chronic bronchitis and 13 with asthma&#59; &#40;D&#41; 17 healthy subjects with AAT levels<span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#44; 14 healthy subjects with AAT levels<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#44; 21 patients with pulmonary disease and AAT levels<span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl and 45 patients with pulmonary disease and AAT levels<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&#59; &#40;E&#41; 5 ZZ asymtomatic patients and 21 ZZ patients with pulmonary disease&#59; &#40;F&#41; 5 ZZ asymptomatic patients&#44; 7 ZZ patients with pulmonary disease and not treated and 14 ZZ patients with pulmonary disease under augmentation therapy&#59; &#40;G&#41; 27 never smokers&#44; 26 current smokers and 41 former smokers&#59; &#40;H&#41; 14 healthy never smokers&#44; 13 never smokers with pulmonary disease&#44; 14 healthy ever smokers and 52 ever smokers with pulmonary disease&#46; Single values&#44; mean and standard deviation of miR-320c expression are shown&#46; &#42; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#46; PD<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>pulmonary disease&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 835
            "Ancho" => 1500
            "Tamanyo" => 45151
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">LPS-induced expression of miR-320c in HL60 cells&#46; Relative expression of miR-320c after 24&#44; 48 and 72<span class="elsevierStyleHsp" style=""></span>h of treatment with LPS&#46; Data represent the mean &#40;&#177; SD&#41; of three independent experiments&#46; &#42; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; &#42;&#42; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;005&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">MM healthy&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">MM COPD<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">MS&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">MZ&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">SZ&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">ZZ&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Other &#40;rare alleles&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>14&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>27&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Sex</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Male&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">AAT serum levels &#40;mg&#47;dl&#41;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100&#8211;220&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100&#8211;188&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">75&#8211;140&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">64&#8211;110&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">41&#8211;60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7&#8211;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11&#8211;91&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">AAT deficiency</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>&#62;100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>50&#8211;100<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>&#60;50<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">27&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Pulmonary disease</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">22&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Type of airway disease</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Bronchiectasis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Emphysema&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">18&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Chronic bronchitis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Asthma&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">FEV1&#37;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">99&#8211;123&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28&#8211;77&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">74&#8211;113&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&#8211;128&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">59&#8211;128&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">23&#8211;118&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">64&#8211;98&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>&#60;50&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">FVC&#47;FEV1&#37;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">67&#8211;96&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">27&#8211;70&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">66&#8211;111&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32&#8211;85&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">41&#8211;85&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24&#8211;99&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">47&#8211;92&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>&#60;70&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Smoking status</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Never&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Current&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Former&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="8" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Replacement therapy</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2647749.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">COPD&#44; chronic obstructive pulmonary disease&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Clinical characteristics of individuals with different AAT genotypes&#46;</p>"
        ]
      ]
      4 => array:5 [
        "identificador" => "fig0020"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "fx1.jpeg"
            "Alto" => 735
            "Ancho" => 1333
            "Tamanyo" => 65783
          ]
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:42 [
            0 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Serum concentration of alpha-1 antitrypsin is significantly higher in colorectal cancer patients than in healthy controls"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "S&#46; Perez-Holanda"
                            1 => "I&#46; Blanco"
                            2 => "M&#46; Menendez"
                            3 => "L&#46; Rodrigo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/1471-2407-14-355"
                      "Revista" => array:5 [
                        "tituloSerie" => "BMC Cancer"
                        "fecha" => "2014"
                        "volumen" => "14"
                        "paginaInicial" => "355"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24886427"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Inhibition of proteinase 3 by &#91;alpha&#93;1-antitrypsin in vitro predicts very fast inhibition in vivo"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46; Duranton"
                            1 => "J&#46;G&#46; Bieth"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Am J Respir Cell Mol Biol"
                        "fecha" => "2003"
                        "volumen" => "29"
                        "paginaInicial" => "57"
                        "paginaFinal" => "61"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Alpha1-antitrypsin deficiency"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46;K&#46; Stoller"
                            1 => "L&#46;S&#46; Aboussouan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/S0140-6736(05)66781-5"
                      "Revista" => array:6 [
                        "tituloSerie" => "Lancet"
                        "fecha" => "2005"
                        "volumen" => "365"
                        "paginaInicial" => "2225"
                        "paginaFinal" => "2236"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15978931"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hereditary alpha-1-antitrypsin deficiency and its clinical consequences"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "L&#46; Fregonese"
                            1 => "J&#46; Stolk"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/1750-1172-3-16"
                      "Revista" => array:5 [
                        "tituloSerie" => "Orphanet J Rare Dis"
                        "fecha" => "2008"
                        "volumen" => "3"
                        "paginaInicial" => "16"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18565211"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Preventing and reversing the cellular consequences of Z alpha-1 antitrypsin accumulation by targeting s4A"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "S&#46; Alam"
                            1 => "J&#46; Wang"
                            2 => "S&#46; Janciauskiene"
                            3 => "R&#46; Mahadeva"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jhep.2012.02.025"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Hepatol"
                        "fecha" => "2012"
                        "volumen" => "57"
                        "paginaInicial" => "116"
                        "paginaFinal" => "124"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22425623"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "alpha1-antitrypsin polymerizes in alveolar macrophages of smokers with and without alpha1-antitrypsin deficiency"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46; Bazzan"
                            1 => "M&#46; Tine"
                            2 => "D&#46; Biondini"
                            3 => "R&#46; Benetti"
                            4 => "S&#46; Baraldo"
                            5 => "G&#46; Turato"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.chest.2018.04.039"
                      "Revista" => array:6 [
                        "tituloSerie" => "Chest"
                        "fecha" => "2018"
                        "volumen" => "154"
                        "paginaInicial" => "607"
                        "paginaFinal" => "616"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29763589"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The discovery of alpha1-antitrypsin and its role in health and disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "S&#46;M&#46; Janciauskiene"
                            1 => "R&#46; Bals"
                            2 => "R&#46; Koczulla"
                            3 => "C&#46; Vogelmeier"
                            4 => "T&#46; Kohnlein"
                            5 => "T&#46; Welte"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Respir Med"
                        "fecha" => "2011"
                        "volumen" => "105"
                        "paginaInicial" => "1129"
                        "paginaFinal" => "1139"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Pathophysiology of alpha-1 antitrypsin deficiency liver disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46;H&#46; Teckman"
                            1 => "K&#46;S&#46; Blomenkamp"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/978-1-4939-7163-3_1"
                      "Revista" => array:6 [
                        "tituloSerie" => "Methods Mol Biol"
                        "fecha" => "2017"
                        "volumen" => "1639"
                        "paginaInicial" => "1"
                        "paginaFinal" => "8"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28752441"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Alpha-1 Antitrypsin Deficiency"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46;K&#46; Stoller"
                            1 => "F&#46;L&#46; Lacbawan"
                            2 => "L&#46;S&#46; Aboussouan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:1 [
                        "fecha" => "1993"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Indications for active case searches and intravenous alpha-1 antitrypsin treatment for patients with alpha-1 antitrypsin deficiency chronic pulmonary obstructive disease&#58; an update"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Casas"
                            1 => "I&#46; Blanco"
                            2 => "M&#46;T&#46; Martinez"
                            3 => "A&#46; Bustamante"
                            4 => "M&#46; Miravitlles"
                            5 => "S&#46; Cadenas"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.arbres.2014.05.008"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arch Bronconeumol"
                        "fecha" => "2015"
                        "volumen" => "51"
                        "paginaInicial" => "185"
                        "paginaFinal" => "192"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25027067"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Clinical features of individuals with PI&#42;SZ phenotype of alpha 1-antitrypsin deficiency&#46; Alpha 1-Antitrypsin Deficiency Registry Study Group"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46;M&#46; Turino"
                            1 => "A&#46;F&#46; Barker"
                            2 => "M&#46;L&#46; Brantly"
                            3 => "A&#46;B&#46; Cohen"
                            4 => "R&#46;P&#46; Connelly"
                            5 => "R&#46;G&#46; Crystal"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1164/ajrccm.154.6.8970361"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Respir Crit Care Med"
                        "fecha" => "1996"
                        "volumen" => "154"
                        "paginaInicial" => "1718"
                        "paginaFinal" => "1725"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8970361"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genetic epidemiology of severe&#44; early-onset chronic obstructive pulmonary disease&#58; risk to relatives for airflow obstruction and chronic bronchitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46;K&#46; Silverman"
                            1 => "H&#46;A&#46; Chapman"
                            2 => "J&#46;M&#46; Drazen"
                            3 => "S&#46;T&#46; Weiss"
                            4 => "B&#46; Rosner"
                            5 => "E&#46;J&#46; Campbell"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Am J Respir Crit Care Med"
                        "fecha" => "1998"
                        "volumen" => "157"
                        "paginaInicial" => "1770"
                        "paginaFinal" => "1778"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Survival and FEV1 decline in individuals with severe deficiency of alpha1-antitrypsin&#46; The Alpha-1-Antitrypsin Deficiency Registry Study Group&#46; Am J Respir Crit Care Med 1998&#59;158&#58;49&#8211;59&#46;"
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "European Respiratory Society statement&#58; diagnosis and treatment of pulmonary disease in alpha1-antitrypsin deficiency"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Miravitlles"
                            1 => "A&#46; Dirksen"
                            2 => "I&#46; Ferrarotti"
                            3 => "V&#46; Koblizek"
                            4 => "P&#46; Lange"
                            5 => "R&#46; Mahadeva"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1183/13993003.00711-2017"
                      "Revista" => array:4 [
                        "tituloSerie" => "Eur Respir J"
                        "fecha" => "2017"
                        "volumen" => "50"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29025888"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Alpha1-antitrypsin deficiency&#46; 2 genetic aspects of alpha&#40;1&#41;-antitrypsin deficiency&#58; phenotypes and genetic modifiers of emphysema risk"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "D&#46;L&#46; DeMeo"
                            1 => "E&#46;K&#46; Silverman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/thx.2003.006502"
                      "Revista" => array:6 [
                        "tituloSerie" => "Thorax"
                        "fecha" => "2004"
                        "volumen" => "59"
                        "paginaInicial" => "259"
                        "paginaFinal" => "264"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14985567"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNAs&#58; genomics&#44; biogenesis&#44; mechanism&#44; and function"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "D&#46;P&#46; Bartel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/s0092-8674(04)00045-5"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cell"
                        "fecha" => "2004"
                        "volumen" => "116"
                        "paginaInicial" => "281"
                        "paginaFinal" => "297"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14744438"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The roles of miRNAs as potential biomarkers in lung diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46;D&#46; Alipoor"
                            1 => "I&#46;M&#46; Adcock"
                            2 => "J&#46; Garssen"
                            3 => "E&#46; Mortaz"
                            4 => "M&#46; Varahram"
                            5 => "M&#46; Mirsaeidi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ejphar.2016.09.015"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur J Pharmacol"
                        "fecha" => "2016"
                        "volumen" => "791"
                        "paginaInicial" => "395"
                        "paginaFinal" => "404"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27634639"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNAs&#58; target recognition and regulatory functions"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "D&#46;P&#46; Bartel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cell.2009.01.002"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cell"
                        "fecha" => "2009"
                        "volumen" => "136"
                        "paginaInicial" => "215"
                        "paginaFinal" => "233"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19167326"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role of microRNAs in chronic respiratory disease&#58; recent insights"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "L&#46;R&#46; Stolzenburg"
                            1 => "A&#46; Harris"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1515/hsz-2017-0249"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biol Chem"
                        "fecha" => "2018"
                        "volumen" => "399"
                        "paginaInicial" => "219"
                        "paginaFinal" => "234"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29148977"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Insights into the miRNA regulations in human disease genes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46; Das"
                            1 => "S&#46; Podder"
                            2 => "T&#46;C&#46; Ghosh"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/1471-2164-15-1010"
                      "Revista" => array:5 [
                        "tituloSerie" => "BMC Genomics"
                        "fecha" => "2014"
                        "volumen" => "15"
                        "paginaInicial" => "1010"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25416156"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Isolation and identification of cell-specific microRNAs targeting a messenger RNA using a biotinylated anti-sense oligonucleotide capture affinity technique"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T&#46; Hassan"
                            1 => "S&#46;G&#46; Smith"
                            2 => "K&#46; Gaughan"
                            3 => "I&#46;K&#46; Oglesby"
                            4 => "S&#46; O&#8217;Neill"
                            5 => "N&#46;G&#46; McElvaney"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/nar/gks1466"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nucleic Acids Res"
                        "fecha" => "2013"
                        "volumen" => "41"
                        "paginaInicial" => "e71"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23325846"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "miR-199a-5p silencing regulates the unfolded protein response in chronic obstructive pulmonary disease and alpha1-antitrypsin deficiency"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T&#46; Hassan"
                            1 => "T&#46;P&#46; Carroll"
                            2 => "P&#46;G&#46; Buckley"
                            3 => "R&#46; Cummins"
                            4 => "S&#46;J&#46; O&#8217;Neill"
                            5 => "N&#46;G&#46; McElvaney"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1164/rccm.201306-1151OC"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Respir Crit Care Med"
                        "fecha" => "2014"
                        "volumen" => "189"
                        "paginaInicial" => "263"
                        "paginaFinal" => "273"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24299514"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Gene and miRNA expression profiles in PBMCs from patients with severe and mild emphysema and PiZZ alpha1-antitrypsin deficiency"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; Esquinas"
                            1 => "S&#46; Janciauskiene"
                            2 => "R&#46; Gonzalo"
                            3 => "X&#46; Mas d"
                            4 => "B&#46; Olejnicka"
                            5 => "I&#46; Belmonte"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2147/COPD.S145445"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Chron Obstruct Pulmon Dis"
                        "fecha" => "2017"
                        "volumen" => "12"
                        "paginaInicial" => "3381"
                        "paginaFinal" => "3390"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29238183"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA and mRNA features of malignant pleural mesothelioma and benign asbestos-related pleural effusion"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46; Ak"
                            1 => "S&#46;C&#46; Tomaszek"
                            2 => "F&#46; Kosari"
                            3 => "M&#46; Metintas"
                            4 => "J&#46;R&#46; Jett"
                            5 => "S&#46; Metintas"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1155/2015/635748"
                      "Revista" => array:5 [
                        "tituloSerie" => "Biomed Res Int"
                        "fecha" => "2015"
                        "volumen" => "2015"
                        "paginaInicial" => "635748"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25756049"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Changed profile of microRNAs in acute lung injury induced by cardio-pulmonary bypass and its mechanism involved with SIRT1"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46; Yang"
                            1 => "B&#46; Gao"
                            2 => "W&#46; Wei"
                            3 => "Z&#46; Li"
                            4 => "L&#46; Pan"
                            5 => "J&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Clin Exp Pathol"
                        "fecha" => "2015"
                        "volumen" => "8"
                        "paginaInicial" => "1104"
                        "paginaFinal" => "1115"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25972997"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MiR-320 and miR-494 affect cell cycles of primary murine bronchial epithelial cells exposed to benzo&#91;a&#93;pyrene"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "H&#46; Duan"
                            1 => "Y&#46; Jiang"
                            2 => "H&#46; Zhang"
                            3 => "Y&#46; Wu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Toxicol In Vitro"
                        "fecha" => "2010"
                        "volumen" => "24"
                        "paginaInicial" => "928"
                        "paginaFinal" => "935"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Characterization of a novel panel of plasma microRNAs that discriminates between <span class="elsevierStyleItalic">Mycobacterium tuberculosis</span> infection and healthy individuals"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46;Y&#46; Cui"
                            1 => "H&#46;W&#46; Liang"
                            2 => "X&#46;L&#46; Pan"
                            3 => "D&#46; Li"
                            4 => "N&#46; Jiao"
                            5 => "Y&#46;H&#46; Liu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pone.0184113"
                      "Revista" => array:5 [
                        "tituloSerie" => "PLOS ONE"
                        "fecha" => "2017"
                        "volumen" => "12"
                        "paginaInicial" => "e0184113"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28910318"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bioinformatic analysis of microRNA and mRNA Regulation in peripheral blood mononuclear cells of patients with chronic obstructive pulmonary disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "X&#46; Dang"
                            1 => "X&#46; Qu"
                            2 => "W&#46; Wang"
                            3 => "C&#46; Liao"
                            4 => "Y&#46; Li"
                            5 => "X&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12931-016-0486-5"
                      "Revista" => array:5 [
                        "tituloSerie" => "Respir Res"
                        "fecha" => "2017"
                        "volumen" => "18"
                        "paginaInicial" => "4"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28057018"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0355"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Conserved seed pairing&#44; often flanked by adenosines&#44; indicates that thousands of human genes are microRNA targets"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "B&#46;P&#46; Lewis"
                            1 => "C&#46;B&#46; Burge"
                            2 => "D&#46;P&#46; Bartel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cell.2004.12.035"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cell"
                        "fecha" => "2005"
                        "volumen" => "120"
                        "paginaInicial" => "15"
                        "paginaFinal" => "20"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15652477"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0360"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Spanish registry of patients with alpha-1 antitrypsin deficiency&#58; database evaluation and population analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46; Lara"
                            1 => "I&#46; Blanco"
                            2 => "M&#46;T&#46; Martinez"
                            3 => "E&#46; Rodriguez"
                            4 => "A&#46; Bustamante"
                            5 => "F&#46; Casas"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.arbres.2016.05.003"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arch Bronconeumol"
                        "fecha" => "2017"
                        "volumen" => "53"
                        "paginaInicial" => "13"
                        "paginaFinal" => "18"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27323654"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0365"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Principles of microRNA-target recognition"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "J&#46; Brennecke"
                            1 => "A&#46; Stark"
                            2 => "R&#46;B&#46; Russell"
                            3 => "S&#46;M&#46; Cohen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pbio.0030085"
                      "Revista" => array:5 [
                        "tituloSerie" => "PLoS Biol"
                        "fecha" => "2005"
                        "volumen" => "3"
                        "paginaInicial" => "e85"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15723116"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0370"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sustained miRNA-mediated knockdown of mutant AAT with simultaneous augmentation of wild-type AAT has minimal effect on global liver miRNA profiles"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; Mueller"
                            1 => "Q&#46; Tang"
                            2 => "A&#46; Gruntman"
                            3 => "K&#46; Blomenkamp"
                            4 => "J&#46; Teckman"
                            5 => "L&#46; Song"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/mt.2011.292"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Ther"
                        "fecha" => "2012"
                        "volumen" => "20"
                        "paginaInicial" => "590"
                        "paginaFinal" => "600"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22252449"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0375"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Sustained knockdown of a disease-causing gene in patient-specific induced pluripotent stem cells using lentiviral vector-based gene therapy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "R&#46; Eggenschwiler"
                            1 => "K&#46; Loya"
                            2 => "G&#46; Wu"
                            3 => "A&#46;D&#46; Sharma"
                            4 => "M&#46; Sgodda"
                            5 => "D&#46; Zychlinski"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.5966/sctm.2013-0017"
                      "Revista" => array:6 [
                        "tituloSerie" => "Stem Cells Transl Med"
                        "fecha" => "2013"
                        "volumen" => "2"
                        "paginaInicial" => "641"
                        "paginaFinal" => "654"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23926210"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0380"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Gene expression profiling of peripheral blood cells for early detection of breast cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Aaroe"
                            1 => "T&#46; Lindahl"
                            2 => "V&#46; Dumeaux"
                            3 => "S&#46; Saebo"
                            4 => "D&#46; Tobin"
                            5 => "N&#46; Hagen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/bcr2472"
                      "Revista" => array:5 [
                        "tituloSerie" => "Breast Cancer Res"
                        "fecha" => "2010"
                        "volumen" => "12"
                        "paginaInicial" => "R7"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20078854"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0385"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Blood transcriptional signatures of multiple sclerosis&#58; unique gene expression of disease activity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "A&#46; Achiron"
                            1 => "M&#46; Gurevich"
                            2 => "N&#46; Friedman"
                            3 => "N&#46; Kaminski"
                            4 => "M&#46; Mandel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/ana.20008"
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Neurol"
                        "fecha" => "2004"
                        "volumen" => "55"
                        "paginaInicial" => "410"
                        "paginaFinal" => "417"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14991819"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0390"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Interferon and granulopoiesis signatures in systemic lupus erythematosus blood"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46; Bennett"
                            1 => "A&#46;K&#46; Palucka"
                            2 => "E&#46; Arce"
                            3 => "V&#46; Cantrell"
                            4 => "J&#46; Borvak"
                            5 => "J&#46; Banchereau"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Exp Med"
                        "fecha" => "2003"
                        "volumen" => "197"
                        "paginaInicial" => "711"
                        "paginaFinal" => "723"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0395"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Transcriptional profiles in peripheral blood mononuclear cells prognostic of clinical outcomes in patients with advanced renal cell carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;E&#46; Burczynski"
                            1 => "N&#46;C&#46; Twine"
                            2 => "G&#46; Dukart"
                            3 => "B&#46; Marshall"
                            4 => "M&#46; Hidalgo"
                            5 => "W&#46;M&#46; Stadler"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Cancer Res"
                        "fecha" => "2005"
                        "volumen" => "11"
                        "paginaInicial" => "1181"
                        "paginaFinal" => "1189"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15709187"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0400"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Effects of alpha 1-antitrypsin on endotoxin-induced lung inflammation in vivo"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Subramaniyam"
                            1 => "C&#46; Steele"
                            2 => "T&#46; Kohnlein"
                            3 => "T&#46; Welte"
                            4 => "O&#46; Grip"
                            5 => "S&#46; Matalon"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00011-010-0164-x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Inflamm Res"
                        "fecha" => "2010"
                        "volumen" => "59"
                        "paginaInicial" => "571"
                        "paginaFinal" => "578"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20238140"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0405"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The BLT1 inhibitory function of alpha-1 antitrypsin augmentation therapy disrupts leukotriene B4 neutrophil signaling"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46;A&#46; O&#8217;Dwyer"
                            1 => "M&#46;E&#46; O&#8217;Brien"
                            2 => "M&#46;R&#46; Wormald"
                            3 => "M&#46;M&#46; White"
                            4 => "N&#46; Banville"
                            5 => "K&#46; Hurley"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4049/jimmunol.1500038"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Immunol"
                        "fecha" => "2015"
                        "volumen" => "195"
                        "paginaInicial" => "3628"
                        "paginaFinal" => "3641"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26371243"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            39 => array:3 [
              "identificador" => "bib0410"
              "etiqueta" => "40"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "alpha-1 Antitrypsin regulates human neutrophil chemotaxis induced by soluble immune complexes and IL-8"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46;A&#46; Bergin"
                            1 => "E&#46;P&#46; Reeves"
                            2 => "P&#46; Meleady"
                            3 => "M&#46; Henry"
                            4 => "O&#46;J&#46; McElvaney"
                            5 => "T&#46;P&#46; Carroll"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1172/JCI41196"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Invest"
                        "fecha" => "2010"
                        "volumen" => "120"
                        "paginaInicial" => "4236"
                        "paginaFinal" => "4250"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21060150"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            40 => array:3 [
              "identificador" => "bib0415"
              "etiqueta" => "41"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The circulating proteinase inhibitor alpha-1 antitrypsin regulates neutrophil degranulation and autoimmunity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46;A&#46; Bergin"
                            1 => "E&#46;P&#46; Reeves"
                            2 => "K&#46; Hurley"
                            3 => "R&#46; Wolfe"
                            4 => "R&#46; Jameel"
                            5 => "S&#46; Fitzgerald"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Sci Transl Med"
                        "fecha" => "2014"
                        "volumen" => "6"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            41 => array:3 [
              "identificador" => "bib0420"
              "etiqueta" => "42"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Alpha-1 antitrypsin augmentation therapy decreases miR-199a-5p&#44; miR-598 and miR-320a expression in monocytes via inhibition of NFkappaB"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "T&#46; Hassan"
                            1 => "S&#46;C&#46; de"
                            2 => "C&#46; Mooney"
                            3 => "N&#46;G&#46; McElvaney"
                            4 => "C&#46;M&#46; Greene"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41598-017-14310-2"
                      "Revista" => array:5 [
                        "tituloSerie" => "Sci Rep"
                        "fecha" => "2017"
                        "volumen" => "7"
                        "paginaInicial" => "13803"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29062067"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack543143"
        "titulo" => "Acknowledgments"
        "texto" => "<p id="par0190" class="elsevierStylePara elsevierViewall">We would like to thank to all the REDAAT &#40;Spanish Registry of Alpha-1 Antitrypsin deficiency patients&#41; collaborators&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/15792129/0000005700000007/v1_202107020656/S1579212921002007/v1_202107020656/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "9374"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/15792129/0000005700000007/v1_202107020656/S1579212921002007/v1_202107020656/en/main.pdf?idApp=UINPBA00003Z&text.app=https://archbronconeumol.org/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212921002007?idApp=UINPBA00003Z"
]