Original Article
Recombinant Human Keratinocyte Growth Factor Induces Akt Mediated Cell Survival Progression in Emphysematous Mice
El factor de crecimiento queratinocítico humano recombinante induce la progresión de la supervivencia celular mediada por Akt en ratones enfisematosos
Jai Prakash Muyala,
, Dhananjay Kumara, Sudhir Kotnalaa, Vandana Muyalb,c, Amit Kumar Tyagid
Corresponding author
a Department of Biotechnology, School of Biotechnology, Gautam Buddha University, Greater Noida, Uttar Pradesh, India
b Department of Internal Medicine, Division of Respiratory Medicine, Philipps-Universität Marburg, Marburg, Germany
c 14/Type V, Gautam Buddha University, Greater Noida, Uttar Pradesh, India
d Division of Nuclear Medicine, Institute of Nuclear Medicine and Allied Sciences, Defense Research Development Organization, New Delhi, India
Read
6052
Timeswas read the article
1790
Total PDF
4262
Total HTML
Share statistics
array:24 [ "pii" => "S1579212915000567" "issn" => "15792129" "doi" => "10.1016/j.arbr.2015.02.023" "estado" => "S300" "fechaPublicacion" => "2015-07-01" "aid" => "995" "copyright" => "SEPAR" "copyrightAnyo" => "2014" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Arch Bronconeumol. 2015;51:328-37" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 2467 "formatos" => array:3 [ "EPUB" => 124 "HTML" => 1849 "PDF" => 494 ] ] "Traduccion" => array:1 [ "es" => array:18 [ "pii" => "S0300289614002233" "issn" => "03002896" "doi" => "10.1016/j.arbres.2014.04.019" "estado" => "S300" "fechaPublicacion" => "2015-07-01" "aid" => "995" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Arch Bronconeumol. 2015;51:328-37" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 4042 "formatos" => array:3 [ "EPUB" => 116 "HTML" => 3237 "PDF" => 689 ] ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original</span>" "titulo" => "El factor de crecimiento queratinocítico humano recombinante induce la progresión de la supervivencia celular mediada por Akt en ratones enfisematosos" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "328" "paginaFinal" => "337" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Recombinant Human Keratinocyte Growth Factor Induces Akt Mediated Cell Survival Progression in Emphysematous Mice" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0025" "etiqueta" => "Figura 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 1187 "Ancho" => 1616 "Tamanyo" => 49983 ] ] "descripcion" => array:1 [ "es" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Expresión relativa del mRNA del antagonista (Pten) de la vía de Akt en el tejido pulmonar completo. El nivel de expresión de Pten mostró una inducción significativa en los pulmones expuestos a elastasa, a diferencia del grupo de tratamiento. En el grupo de tratamiento hubo una disminución significativa de los niveles de expresión de Pten, con unos resultados comparables a los del grupo de control. Los niveles de mRNA de los genes diana se determinaron con los valores relativos respecto al gen de referencia endógeno de la actina β según la fórmula de 2 elevado a la potencia de delta del umbral de ciclo (2<span class="elsevierStyleSup">ΔCt)</span>, en donde ΔCt<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>Ct, gen de referencia–Ct, gen diana. Los gráficos indican los valores de media con desviación estándar. Los datos se analizaron mediante la prueba de t para datos no emparejados, con objeto de evaluar el efecto del rHuKGF y la elastasa, respectivamente. EK: elastasa- rHuKGF (grupo de tratamiento); ES: elastasa-solución salina (grupo de enfisema); rHuKGF: factor de crecimiento queratinocítico humano recombinante; SS: solución salina (grupo sano); VEGF: factor de crecimiento endotelial vascular. *p<span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0,05 y **p ≤ 0,01 frente al respectivo grupo de control.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Jai Prakash Muyal, Dhananjay Kumar, Sudhir Kotnala, Vandana Muyal, Amit Kumar Tyagi" "autores" => array:5 [ 0 => array:2 [ "nombre" => "Jai" "apellidos" => "Prakash Muyal" ] 1 => array:2 [ "nombre" => "Dhananjay" "apellidos" => "Kumar" ] 2 => array:2 [ "nombre" => "Sudhir" "apellidos" => "Kotnala" ] 3 => array:2 [ "nombre" => "Vandana" "apellidos" => "Muyal" ] 4 => array:2 [ "nombre" => "Amit" "apellidos" => "Kumar Tyagi" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S1579212915000567" "doi" => "10.1016/j.arbr.2015.02.023" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212915000567?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289614002233?idApp=UINPBA00003Z" "url" => "/03002896/0000005100000007/v2_201506280052/S0300289614002233/v2_201506280052/es/main.assets" ] ] "itemSiguiente" => array:19 [ "pii" => "S1579212915000464" "issn" => "15792129" "doi" => "10.1016/j.arbr.2015.02.014" "estado" => "S300" "fechaPublicacion" => "2015-07-01" "aid" => "1067" "copyright" => "SEPAR" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Arch Bronconeumol. 2015;51:338-43" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 3054 "formatos" => array:3 [ "EPUB" => 153 "HTML" => 2212 "PDF" => 689 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>" "titulo" => "Fluoroscopic-Guided Radial Endobronchial Ultrasound Without Guide Sheath for Peripheral Pulmonary Lesions: A Safe and Efficient Combination" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "338" "paginaFinal" => "343" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Ecografía endobronquial radial guiada por fluoroscopia sin vaina guía para lesiones pulmonares periféricas: una relación segura y eficiente" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1424 "Ancho" => 1672 "Tamanyo" => 112509 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Main operator learning curves showing the diagnostic yield of F-R-EBUS, the total number of tools, and the mean size of lesions for the 4 subgroups of consecutive patients.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Alessio Casutt, Maura Prella, Catherine Beigelman-Aubry, Jean-William Fitting, Laurent Nicod, Angela Koutsokera, Alban Lovis" "autores" => array:7 [ 0 => array:2 [ "nombre" => "Alessio" "apellidos" => "Casutt" ] 1 => array:2 [ "nombre" => "Maura" "apellidos" => "Prella" ] 2 => array:2 [ "nombre" => "Catherine" "apellidos" => "Beigelman-Aubry" ] 3 => array:2 [ "nombre" => "Jean-William" "apellidos" => "Fitting" ] 4 => array:2 [ "nombre" => "Laurent" "apellidos" => "Nicod" ] 5 => array:2 [ "nombre" => "Angela" "apellidos" => "Koutsokera" ] 6 => array:2 [ "nombre" => "Alban" "apellidos" => "Lovis" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S0300289614003925" "doi" => "10.1016/j.arbres.2014.09.017" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289614003925?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212915000464?idApp=UINPBA00003Z" "url" => "/15792129/0000005100000007/v1_201506250123/S1579212915000464/v1_201506250123/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1579212915000555" "issn" => "15792129" "doi" => "10.1016/j.arbr.2015.02.022" "estado" => "S300" "fechaPublicacion" => "2015-07-01" "aid" => "991" "copyright" => "SEPAR" "documento" => "article" "crossmark" => 1 "subdocumento" => "fla" "cita" => "Arch Bronconeumol. 2015;51:322-7" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 2626 "formatos" => array:3 [ "EPUB" => 153 "HTML" => 1797 "PDF" => 676 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>" "titulo" => "Imaging Findings of Isolated Bronchial Anthracofibrosis: A Computed Tomography Analysis of Patients With Bronchoscopic and Histologic Confirmation" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "322" "paginaFinal" => "327" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Diagnóstico por la imagen de la antracofibrosis bronquial aislada: un análisis de tomografía computarizada de pacientes con confirmación broncoscópica e histológica" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2052 "Ancho" => 982 "Tamanyo" => 208410 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">A 58-year-old male with cough and dyspnea. (a) CT with lung window demonstrates multiple bilateral intraparenchymal peribronchial cuffing (<span class="elsevierStyleItalic">arrows</span>). (b) Chest CT shows right-sided segmental calcified lymph node with pressure effect on adjacent bronchus (<span class="elsevierStyleItalic">arrow</span>).</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Shahram Kahkouee, Ramin Pourghorban, Mahdi Bitarafan, Katayoun Najafizadeh, Seyed Shahabeddin Mohammad Makki" "autores" => array:5 [ 0 => array:2 [ "nombre" => "Shahram" "apellidos" => "Kahkouee" ] 1 => array:2 [ "nombre" => "Ramin" "apellidos" => "Pourghorban" ] 2 => array:2 [ "nombre" => "Mahdi" "apellidos" => "Bitarafan" ] 3 => array:2 [ "nombre" => "Katayoun" "apellidos" => "Najafizadeh" ] 4 => array:2 [ "nombre" => "Seyed Shahabeddin Mohammad" "apellidos" => "Makki" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S0300289614002191" "doi" => "10.1016/j.arbres.2014.04.018" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289614002191?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212915000555?idApp=UINPBA00003Z" "url" => "/15792129/0000005100000007/v1_201506250123/S1579212915000555/v1_201506250123/en/main.assets" ] "en" => array:21 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>" "titulo" => "Recombinant Human Keratinocyte Growth Factor Induces Akt Mediated Cell Survival Progression in Emphysematous Mice" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "328" "paginaFinal" => "337" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Jai Prakash Muyal, Dhananjay Kumar, Sudhir Kotnala, Vandana Muyal, Amit Kumar Tyagi" "autores" => array:5 [ 0 => array:4 [ "nombre" => "Jai" "apellidos" => "Prakash Muyal" "email" => array:1 [ 0 => "jmuyal@gbu.ac.in" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "Dhananjay" "apellidos" => "Kumar" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 2 => array:3 [ "nombre" => "Sudhir" "apellidos" => "Kotnala" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] 3 => array:3 [ "nombre" => "Vandana" "apellidos" => "Muyal" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 4 => array:3 [ "nombre" => "Amit Kumar" "apellidos" => "Tyagi" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff0020" ] ] ] ] "afiliaciones" => array:4 [ 0 => array:3 [ "entidad" => "Department of Biotechnology, School of Biotechnology, Gautam Buddha University, Greater Noida, Uttar Pradesh, India" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Department of Internal Medicine, Division of Respiratory Medicine, Philipps-Universität Marburg, Marburg, Germany" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "14/Type V, Gautam Buddha University, Greater Noida, Uttar Pradesh, India" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Division of Nuclear Medicine, Institute of Nuclear Medicine and Allied Sciences, Defense Research Development Organization, New Delhi, India" "etiqueta" => "d" "identificador" => "aff0020" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "El factor de crecimiento queratinocítico humano recombinante induce la progresión de la supervivencia celular mediada por Akt en ratones enfisematosos" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1663 "Ancho" => 2469 "Tamanyo" => 204013 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Schematic outline of the experimental setup. On day 0 and day 10, mice received an oropharyngeal instillation of 40<span class="elsevierStyleHsp" style=""></span>μl of saline with or without porcine pancreatic elastase (2.5<span class="elsevierStyleHsp" style=""></span>mg/kg body weight). On day 31, 34 and 37, animals received an oropharyngeal instillation of 40<span class="elsevierStyleHsp" style=""></span>μl of saline or with rHuKGF (10<span class="elsevierStyleHsp" style=""></span>mg/kg body weight). At day 40, animals were sacrificed and lungs removed for analysis by histopathology and molecular biology. ES=Elastase–saline (emphysema group); SS=Saline–saline (healthy group); EK=Elastase–rHuKGF (therapy group).</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Chronic obstructive pulmonary disease (COPD) is a major healthcare burden worldwide, and the only leading cause of death that is increasing in prevalence.<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">1</span></a> In the United States, it accounts for a morbidity of 4%, and is the fourth leading cause of death.<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">1</span></a> Pulmonary emphysema, which comes under COPD, is an anatomic pathological diagnosis defined by permanent destructive enlargement of airspaces distal to the terminal bronchioles, contributing to airflow limitation. It is thought to be irreversible.<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">2</span></a> As yet, no effective treatment is available to re-establish normal gas exchanging lung parenchyma after emphysematous changes have been established. Although promising results with All-trans-retinoic acid therapy have been reported in rodent models of emphysema,<a class="elsevierStyleCrossRef" href="#bib0295"><span class="elsevierStyleSup">3</span></a> there is no proven clinically effective treatment to promote recovery from established emphysema.<a class="elsevierStyleCrossRefs" href="#bib0300"><span class="elsevierStyleSup">4,5</span></a> Hence, the induction of alveolar regeneration is still a major challenge in the development of novel therapies for emphysema.<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">6</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">Keratinocyte growth factor (KGF) is a potent mitogen for different types of epithelial cells and assists in the repair of the skin, cornea and gastrointestinal lining by stimulating cells division and growth.<a class="elsevierStyleCrossRefs" href="#bib0315"><span class="elsevierStyleSup">7–9</span></a> This repair action has sparked interest in its potential use to treat epithelial injury in acute lung injury (ALI).<a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">10</span></a> KGF modulates several mechanisms known to be important in alveolar epithelial repair, and has therefore been targeted as a possible therapeutic intervention in ALI. The first study on the protective effect of exogenous KGF in a rodent model with ALI was reported by Panos et al.,<a class="elsevierStyleCrossRef" href="#bib0335"><span class="elsevierStyleSup">11</span></a> who found that intratracheal administration of rHuKGF stimulated in vivo alveolar epithelial type 2 (AE2) cell proliferation and reduced hyperoxia-induced lung injury in rats. Subsequently, exogenous KGF has been extensively studied to protect lung tissue against experimental lung injury, including bleomycin,<a class="elsevierStyleCrossRefs" href="#bib0340"><span class="elsevierStyleSup">12,13</span></a><span class="elsevierStyleItalic">Pseudomonas aeruginosa</span> pneumonia,<a class="elsevierStyleCrossRef" href="#bib0350"><span class="elsevierStyleSup">14</span></a> hydrochloric acid,<a class="elsevierStyleCrossRefs" href="#bib0355"><span class="elsevierStyleSup">15,16</span></a> oleic acid,<a class="elsevierStyleCrossRef" href="#bib0365"><span class="elsevierStyleSup">17</span></a> and radiation- and bleomycin-induced lung injury.<a class="elsevierStyleCrossRef" href="#bib0370"><span class="elsevierStyleSup">18</span></a> Recently, data from a human ex vivo lung perfusion model of endotoxin-induced lung injury showed that KGF treatment improved lung endothelial and epithelial barrier function and improved the rate of alveolar fluid clearance, hence reducing alveolar oedema.<a class="elsevierStyleCrossRef" href="#bib0375"><span class="elsevierStyleSup">19</span></a> Interestingly, supplementation of rHuKGF into emphysematous lungs shows regeneration of alveolar epithelium and capillary endothelium as well as interstitial tissue formation and maintenance.<a class="elsevierStyleCrossRef" href="#bib0380"><span class="elsevierStyleSup">20</span></a> In addition, KGF has a tendency to stimulate vascular endothelial growth factor (VEGF) production in human keratinocytes.<a class="elsevierStyleCrossRefs" href="#bib0385"><span class="elsevierStyleSup">21–23</span></a> VEGF is an endothelial cell (EC)-specific mitogen and is involved in wound repair, angiogenesis, microvascular permeability and vascular protection. However, its expression in cells is strictly regulated by growth factors.<a class="elsevierStyleCrossRef" href="#bib0390"><span class="elsevierStyleSup">22</span></a> These growth factors do not normally stimulate angiogenesis directly, but can modulate angiogenesis by modulating VEGF expression in specific cell types, and thus exert an indirect angiogenic or anti-angiogenic effect.<a class="elsevierStyleCrossRef" href="#bib0400"><span class="elsevierStyleSup">24</span></a> Among these, fibroblast growth factor 4 (FGF-4),<a class="elsevierStyleCrossRef" href="#bib0405"><span class="elsevierStyleSup">25</span></a> KGF,<a class="elsevierStyleCrossRef" href="#bib0410"><span class="elsevierStyleSup">26</span></a> PDGF<a class="elsevierStyleCrossRef" href="#bib0415"><span class="elsevierStyleSup">27</span></a> and transforming growth factor β (TGF-β)<a class="elsevierStyleCrossRef" href="#bib0420"><span class="elsevierStyleSup">28</span></a> can potentiate VEGF production, which in turn activates the phosphatidylinositide-3′-OH kinase (PI3K)-Akt pathway.<a class="elsevierStyleCrossRef" href="#bib0425"><span class="elsevierStyleSup">29</span></a> Particularly in the lung, the PI3K-Akt pathway regulates multiple cellular processes, including alveolar cell proliferation, survival, growth, and motility.<a class="elsevierStyleCrossRefs" href="#bib0430"><span class="elsevierStyleSup">30,31</span></a> Hence, in this study, we investigated the potential role of exogenous supplementation of KGF in inducing Akt-mediated cell survival pathway by activating the PI3K and its downstream targets in emphysema (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>).</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Materials and Methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Animal Model Preparation</span><p id="par0015" class="elsevierStylePara elsevierViewall">All animal experiments were performed according to institutional guidelines that comply with national and international regulations, and have been approved by the regional government (IAEC, Ministry of Environment and Forests, India). All experimental animal models were prepared as described by Yildirim et al.<a class="elsevierStyleCrossRef" href="#bib0380"><span class="elsevierStyleSup">20</span></a> Pathogen-free 8 week old C57BL male mice with a body weight of around 20<span class="elsevierStyleHsp" style=""></span>g were randomly assigned to 3 different experimental groups. Mice were maintained under anaesthesia by isofluran and were given either elastase or rHuKGF/saline by oropharyngeal instillation. The development of the experimental models is described in detail below and <a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>:<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">-</span><p id="par0020" class="elsevierStylePara elsevierViewall">Control model (saline+saline=SS, n=8): Oropharyngeal instillation was used to deliver 40<span class="elsevierStyleHsp" style=""></span>μl saline at day 1, 10, 31, 34 and 37.</p></li><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel">-</span><p id="par0025" class="elsevierStylePara elsevierViewall">Emphysema model (elastase+saline=ES; n=8): Emphysema was induced by oropharyngeal instillation of porcine pancreatic elastase [PPE; 2.25<span class="elsevierStyleHsp" style=""></span>mg/kg b.w] into lungs of mice at day 1 and 10. However, elastase-treated lungs received saline at day 31, 34 and 37.</p></li><li class="elsevierStyleListItem" id="lsti0015"><span class="elsevierStyleLabel">-</span><p id="par0030" class="elsevierStylePara elsevierViewall">Therapeutic model for emphysema (elastase+rHuKGF=EK; n=8): Elastase treated lungs received 10<span class="elsevierStyleHsp" style=""></span>mg/kg b.w of recombinant human keratinocyte growth factor (rHuKGF) per oropharyngeal instillation at day 31, 34 and 37, respectively.</p></li></ul></p><elsevierMultimedia ident="fig0010"></elsevierMultimedia><p id="par0035" class="elsevierStylePara elsevierViewall">At day 40, animals were sacrificed by cervical dislocation. Lungs were artificially ventilated and perfused with sterile phosphate buffer saline to remove blood. The right lung was used for histopathology analyses, whereas the left lung tissues were dipped immediately in liquid nitrogen tank and stored at −80<span class="elsevierStyleHsp" style=""></span>°C until used for molecular biology based studies.</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Lung Fixation</span><p id="par0040" class="elsevierStylePara elsevierViewall">Right lungs were fixed by airway instillation with 6% phosphate-buffered paraformaldehyde at a pressure of 20<span class="elsevierStyleHsp" style=""></span>cm fluid column, and were stored overnight in the refrigerator. Dehydration, clearing, and infiltration were performed using standard protocols. The processed tissue slices were placed in a block of molten paraffin and allowed to cool and solidify before slicing. Subsequently, tissue was deparaffinised 3 times by Xylene and rehydrated with different concentrations of ethanol. Using a microtome (Spencers rotary microtome, India), 5<span class="elsevierStyleHsp" style=""></span>μm tissue sections were cut. The sliced tissue sections were stained with haematoxylin and eosin (H&E) stain.</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Morphometry</span><p id="par0045" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Parenchymal destruction</span>: A microscopic point count technique known as destructive index analysis was used to determine the degree of parenchymal destruction.<a class="elsevierStyleCrossRef" href="#bib0440"><span class="elsevierStyleSup">32</span></a> A transparent sheet with 83 counting points was laid on an A4-size print of microscopic images from the stained sections. From each lung specimen, an average of 3 different sections were used. From these sections, 3 representative non-overlapping fields were usually selected. Destruction was evaluated by counting the points overlapping alveolar and duct spaces, as discussed by Robbesom et al.<a class="elsevierStyleCrossRef" href="#bib0445"><span class="elsevierStyleSup">33</span></a> The percentage of all the points falling into the different categories of destroyed air spaces was computed to reveal the Destructive Index, using the formula [D/(D+N)]×100%, where D=destroyed, and N=normal. Differences in DI between emphysema and therapy groups were calculated with respect to control (100%).</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Isolation of Total RNA from the Left Lung Tissue and cDNA Synthesis</span><p id="par0050" class="elsevierStylePara elsevierViewall">To investigate the relative mRNA expression in lung tissue, total RNA was extracted using the RNeasy Mini Kit (Qiagen, New Delhi, India) with a minor modification in the protocol proposed by Muyal et al.<a class="elsevierStyleCrossRef" href="#bib0450"><span class="elsevierStyleSup">34</span></a> The quantity and purity of total RNA was determined with Nanodrop (Thermo Scientific, USA), while the quality of total RNA integrity was assessed by analysing 18S and 28S ribosomal RNA on 1.2% ethidium-bromide stained agarose gel electrophoresis. First-strand cDNA was synthesised by introducing equal amounts of RNA (300<span class="elsevierStyleHsp" style=""></span>ng) from each sample in a total reaction volume of 20<span class="elsevierStyleHsp" style=""></span>μl using an Oligo dt primer (Qiagen, New Delhi, India) and Omniscript RT Kit (Qiagen, New Delhi, India) and their respective protocols. The reaction was incubated at 37<span class="elsevierStyleHsp" style=""></span>°C for 1<span class="elsevierStyleHsp" style=""></span>h in Thermoblock TB2 (Biometra, Goettingen, Germany).</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Relative mRNA Quantification</span><p id="par0055" class="elsevierStylePara elsevierViewall">Real-time PCR for determining the amplification factor of the target genes (see <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>) was performed in a 96-well format Stratagene Mx 3005P (Agilent Technologies, Inc., USA) in 20<span class="elsevierStyleHsp" style=""></span>μl total reaction volume using 10<span class="elsevierStyleHsp" style=""></span>μl an QuantiTect SYBR Green PCR Kit (Qiagen, New Delhi, India), 1<span class="elsevierStyleHsp" style=""></span>μl each of sequence-specific forward and reverse oligonucleotide primers (10<span class="elsevierStyleHsp" style=""></span>pmol), 7<span class="elsevierStyleHsp" style=""></span>μl water, and 1<span class="elsevierStyleHsp" style=""></span>μl cDNA. The thermal cycle conditions used for all reactions were as follows: Step 1: 95<span class="elsevierStyleHsp" style=""></span>°C for 15<span class="elsevierStyleHsp" style=""></span>min; at 30 cycles of Step 2 (95<span class="elsevierStyleHsp" style=""></span>°C for 45<span class="elsevierStyleHsp" style=""></span>s), Step 3 (annealing temperature of the sequence-specific oligonucleotide primer, see <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>, for 35<span class="elsevierStyleHsp" style=""></span>s) and Step 4 (72<span class="elsevierStyleHsp" style=""></span>°C for 45<span class="elsevierStyleHsp" style=""></span>s), followed by step 5 (performed once): 72<span class="elsevierStyleHsp" style=""></span>°C, 5<span class="elsevierStyleHsp" style=""></span>min.</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Protein Isolation and Western Blotting for VEGF</span><p id="par0060" class="elsevierStylePara elsevierViewall">Total protein was extracted from 100<span class="elsevierStyleHsp" style=""></span>mg WLT using total protein extraction kit (Biochem Life Sciences, New Delhi, India). The VEGF western blot protocol was performed as described by Fehrenbach et al. for VEGFR2.<a class="elsevierStyleCrossRef" href="#bib0380"><span class="elsevierStyleSup">20</span></a></p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Statistical Analysis of Relative mRNA Quantification</span><p id="par0065" class="elsevierStylePara elsevierViewall">mRNA levels of target genes were determined relative to the endogenous control β-actin, according to the formula 2 to the power of delta cycle threshold (2<span class="elsevierStyleSup">ΔCt</span>), where ΔCt=Ct, reference gene–Ct, test gene. Differences between experimental groups were tested for significance using nonparametric Mann–Whitney test (GraphPad Prism version 4, San Diego, USA). Levels of significance are indicated by *=<span class="elsevierStyleItalic">P</span><.05; **=<span class="elsevierStyleItalic">P</span><.01.</p></span></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Results</span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Effects of rHuKGF on Tissue Architecture</span><p id="par0070" class="elsevierStylePara elsevierViewall">Oropharyngeal instillation of 2.25<span class="elsevierStyleHsp" style=""></span>mg PPE/kg b.w. on 2 occasions (Days 0, 10) resulted in severe pulmonary emphysema, as shown in the photomicrograph generated from the histopathology study (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>I-B). However, the photomicrograph for rHuKGF-treated emphysematous lungs clearly shows the recovery of lost alveolar septa in the therapy group (EK, <a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>I-C), and was comparable to control (SS, <a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>I-A). Upon determination of destructive index (DI) of tissue slices from all 3 animal models (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>I-D–F), emphysematous mouse models showed significantly higher DI values than control models (<span class="elsevierStyleItalic">P</span><.001). However, the DI was significantly reduced (<span class="elsevierStyleItalic">P</span><.001) in therapy models i.e. rHuKGF-treated emphysematous lungs of mice (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>I).</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Effects of rHuKGF on VEGF, VEGFR, PI3K, and Akt</span><p id="par0075" class="elsevierStylePara elsevierViewall">In normal condition, VEGF binds with VEGFR2 to activate the Akt signalling cascade downstream, which in turn mediates cell survival (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>). To determine whether supplementation of rHuKGF induces the Akt signalling cascade in emphysematous lungs, we evaluated the mRNA expression levels of VEGF, VEGFR 2, PI3K, and Akt, respectively. In contrast to emphysematous lungs, the therapy group (EK) showed good induction in the mRNA levels of VEGF (<span class="elsevierStyleItalic">P</span><.05), VEGFR2 (<span class="elsevierStyleItalic">P</span><.03), PI3K (<span class="elsevierStyleItalic">P</span><.001), and Akt (<span class="elsevierStyleItalic">P</span><.02), respectively. However, the expression of these genes was markedly more reduced in emphysematous lungs (ES) than in healthy ones (SS) (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>I). Furthermore, upon validation of VEGF expression at protein level, the western blot analysis for VEGF showed a similar pattern as that observed at mRNA level (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>II).</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Effects of rHuKGF on Akt Pathway Antagonists</span><p id="par0080" class="elsevierStylePara elsevierViewall">PTEN has been reported as a negative regulator in Akt cell survival pathway. Over-expression of this gene results in deregulation in cell survival signalling. Here, our data shows significantly more up-regulation in mRNA expression of PTEN (<span class="elsevierStyleItalic">P</span><.04) in emphysematous lungs (ES) than in healthy ones (SS). The beneficial role of rHuKGF in emphysema lungs was further noted when a significant reduction in the mRNA level of PTEN (<span class="elsevierStyleItalic">P</span><.008) was observed in the ES group, and importantly, was comparable to healthy lungs (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>).</p><elsevierMultimedia ident="fig0025"></elsevierMultimedia></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Effects of rHuKGF on Apoptotic Markers</span><p id="par0085" class="elsevierStylePara elsevierViewall">To lose alveolar units, alveolar cell apoptosis would be expected even in porcine pancreatic elastase model of emphysema. To assess apoptosis in our experimental animal models, the mRNA expression of apoptotic markers, i.e., Caspase-9 and Bad, were studied in the Akt pathway. Here, the normalised mRNA levels of Caspase-9 (<span class="elsevierStyleItalic">P</span><.01) and Bad (<span class="elsevierStyleItalic">P</span><.01) in emphysematous lung tissue (ES) were significantly more up-regulated than in healthy lungs (SS). However, a promising effect of rHuKGF in emphysema (EK) was observed. In the therapy group (EK), we found more reduced expression levels of Caspase-9 (<span class="elsevierStyleItalic">P</span><.02) and Bad (<span class="elsevierStyleItalic">P</span><.0007) than in emphysematous lungs (ES), which indicates that rHuKGF has a tendency to counteract alveolar cell apoptosis (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>).</p><elsevierMultimedia ident="fig0030"></elsevierMultimedia></span></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Discussion</span><p id="par0090" class="elsevierStylePara elsevierViewall">The pathogenesis of pulmonary emphysema is not fully understood, although several mechanisms have been proposed, including an imbalance of proteases and antiproteases, chronic inflammation and oxidative stress. In addition to these mechanisms, recent studies suggest another mechanism involved in the development of pulmonary emphysema, which is based on an increase in apoptotic alveolar epithelial and endothelial cells in the lungs.<a class="elsevierStyleCrossRef" href="#bib0455"><span class="elsevierStyleSup">35</span></a> However, pulmonary emphysema may also be interpreted as the consequence of a failure of the repair processes of the lung. At present, there are no therapeutic options available that allow the repair of lost alveoli in emphysematous condition. Hence, the induction of alveolar regeneration is still a major challenge in the development of novel therapies for emphysema. Only recently, administration of KGF has proved to be a potent growth factor that possesses both protective as well as curative properties in emphysema.<a class="elsevierStyleCrossRefs" href="#bib0380"><span class="elsevierStyleSup">20,36</span></a> However, the downstream molecular mechanism governing survival of the alveolar cell has not been explored so far. Hence, in this study, we attempted to demonstrate the potential effect of rHuKGF in the activation of the Akt signalling cascade by the stimulation of VEGF production in emphysematous mice.</p><p id="par0095" class="elsevierStylePara elsevierViewall">Our findings strongly suggested a potential role of rHuKGF in the emphysematous lungs of mice. The prospective role of rHuKGF was well observed in the tissue architecture using the histopathology and morphometry destructive index (DI) analysis. The photomicrographs show the loss of alveolar septa in emphysematous lungs when compared with healthy ones. This loss of alveolar septa was recovered in the therapy group, and was very comparable to healthy groups. Similar findings have also been reported by Fehrenbach et al., where mean intercept length was used to quantify the damage and recovery of alveolar tissue.<a class="elsevierStyleCrossRef" href="#bib0380"><span class="elsevierStyleSup">20</span></a> Here, we used destructive index (DI)-based analysis as a tool to quantify both the damage and recovery of alveolar tissue to assess the prospective role of rHuKGF. The average DI value of emphysematous lungs is higher than that of healthy lungs. A similarly high DI value in heavy smokers versus control was also observed by Robbesom et al.<a class="elsevierStyleCrossRef" href="#bib0445"><span class="elsevierStyleSup">33</span></a> We believe that the higher DI values may be due to the stringency of our measurement conditions, ruling out possible biases such as suboptimally inflated tissue. Interestingly, the DI values were significantly reduced upon supplementation of rHuKGF in emphysematous lungs. Such reciprocation in DI values may be due to regeneration of alveolar septa walls, which resulted in increased numbers of intact alveolar spaces. After investigating the prospective role of rHuKGF on tissue architecture, we then did the same with rHuKGF in the Akt signalling cascade in emphysematous mice lungs.</p><p id="par0100" class="elsevierStylePara elsevierViewall">As reported by Shiojima and Walsh,<a class="elsevierStyleCrossRef" href="#bib0465"><span class="elsevierStyleSup">37</span></a> binding of VEGF to the VEGFR2 activates the Akt signalling cascade, which is important in mediating cell survival, proliferation, migration, and angiogenesis. In addition, KGF has a potential tendency to induce Akt activation, which may be the common underlying mechanism of epithelial cell cytoprotection in different tissues.<a class="elsevierStyleCrossRefs" href="#bib0470"><span class="elsevierStyleSup">38,39</span></a> In the lung, similar results were obtained by Ray et al., who reported that KGF stimulates the secretion of VEGF, which enhances cytoprotection of endothelial cells by Akt activation.<a class="elsevierStyleCrossRefs" href="#bib0480"><span class="elsevierStyleSup">40,41,29</span></a> Here, upon supplementation of rHuKGF in emphysematous lungs, the mRNA levels of candidate genes (VEGF, VEGFR2, PI3K and Akt), involved in the Akt signalling cascade were found to be up-regulated to the optimum level observed in healthy condition. In addition, protein expression of VEGF was significantly induced in rHuKGF-received emphysematous lungs. This suggests that rHuKGF has the potential to establish normal lung architecture following loss of alveolar tissues by stimulating VEGF expression in emphysematous lungs. It has been reported earlier that in emphysematous lungs of smokers and patients with COPD, the mRNA and protein expression of VEGF and VEGFR2 was down-regulated.<a class="elsevierStyleCrossRef" href="#bib0490"><span class="elsevierStyleSup">42</span></a> This reduction in VEGF/VEGFR expression may lead to endothelial cell apoptosis and emphysematous changes.<a class="elsevierStyleCrossRefs" href="#bib0495"><span class="elsevierStyleSup">43–46</span></a></p><p id="par0105" class="elsevierStylePara elsevierViewall">In addition, KGF-supplemented emphysematous lungs show an induction in the mRNA levels of PI-3K, which were reduced in emphysematous lungs. Such induction of PI-3K improves the interaction of VEGFR2 with PI-3K for activation of the downstream signalling cascade, thus maintaining cell viability.<a class="elsevierStyleCrossRef" href="#bib0515"><span class="elsevierStyleSup">47</span></a> Furthermore, the favourable effect of rHuKGF was also noticed at the mRNA level of Akt. The expression, which was reduced in the emphysema group, was found to be increased after supplementation of rHuKGF in emphysematous lungs. Such induction in the expression of Akt may have multiple beneficial effects on cellular processes, particularly in alveolar cell proliferation and survival. The induction in Akt kinase activity by KGF in a dose- and time-dependent manner has also been discussed by Shenying et al.<a class="elsevierStyleCrossRef" href="#bib0520"><span class="elsevierStyleSup">48</span></a> This group concluded that KGF is most effective in maintaining cell viability by stimulating Akt kinase activity before exposure to apoptosis-inducing stimuli.<a class="elsevierStyleCrossRef" href="#bib0520"><span class="elsevierStyleSup">48</span></a></p><p id="par0110" class="elsevierStylePara elsevierViewall">We further found that rHuKGF has the potential to minimise over-expression of PTEN and caspase-9 to optimum level in emphysematous lungs. PTEN acts as an antagonist of cell survival by down-regulating the Akt pathway through dephosphorylation,<a class="elsevierStyleCrossRef" href="#bib0525"><span class="elsevierStyleSup">49</span></a> and hence inhibition of phosphatidylinositol 3,4,5-trisphosphate [PI (3,4,5) P3]. Over-expression of PTEN in alveolar epithelium has been reported to cause a marked reduction in cell proliferation, a marked increase in apoptosis, and an incomplete functional differentiation, thus negatively regulating the cell survival pathway.<a class="elsevierStyleCrossRef" href="#bib0530"><span class="elsevierStyleSup">50</span></a> Similarly, increased expression of caspase-9 has been found to be involved in cell apoptosis and decreased cell survival.<a class="elsevierStyleCrossRef" href="#bib0535"><span class="elsevierStyleSup">51</span></a> Here, the mRNA levels of PTEN and caspase-9 in rHuKGF-supplemented emphysematous lungs were down-regulated in contrast to emphysematous lungs. Such favourable changes might be due to suppressed over-expression of PTEN and caspase-9<a class="elsevierStyleCrossRef" href="#bib0520"><span class="elsevierStyleSup">48</span></a> and induced Akt activation, which favours decreased alveolar cell apoptosis and increased cell survival.</p><p id="par0115" class="elsevierStylePara elsevierViewall">The pro-apoptotic Bad is the primary target of Akt, and Akt phosphorylates Bad, thus rendering it inactive for apoptotic signal.<a class="elsevierStyleCrossRefs" href="#bib0540"><span class="elsevierStyleSup">52,53</span></a> Datta et al. hypothesised that the PI3K/Akt pathway may lead to Bad phosphorylation and may thereby suppress cell death and promote cell survival.<a class="elsevierStyleCrossRefs" href="#bib0550"><span class="elsevierStyleSup">54,55</span></a> Particularly in emphysema, Hu et al.<a class="elsevierStyleCrossRef" href="#bib0560"><span class="elsevierStyleSup">56</span></a> showed an increased expression of Bad in human airway smooth muscle cells. Here, the expression of Bad was found to be more up-regulated in emphysematous lungs than in healthy ones, which might be due to the failure of Akt-phosphorylating Bad. However, the potential effect of rHuKGF on Bad was further assessed in emphysematous lungs. The expression of Bad was markedly more down-regulated in the therapy group than in emphysematous lungs, and was identical to healthy lungs. These findings again highlight the potential beneficial effects of rHuKGF supplementation in cell survival and maintenance programme.</p><p id="par0120" class="elsevierStylePara elsevierViewall">The data generated from this study strongly suggests that rHuKGF can be a potent molecular medicine, which may induce the endogenous VEGF conferring important survival signals necessary for the maintenance of the normal lung structure.</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Conclusion</span><p id="par0125" class="elsevierStylePara elsevierViewall">The findings from this study demonstrate the therapeutic efficacy of rHuKGF to rectify the Akt-dependent cell survival pathway that is deregulated in emphysema. The favourable effects were noticed in the architecture and quantitative analysis of tissue. Furthermore, genes that are associated with the Akt-dependent cell survival pathway regulating alveolar cell survival were constructively expressed in accordance with the exogenous rHuKGF supplementation in emphysematous lungs. Taken collectively, the maintenance of alveolar cell survival in the therapy group due to the amelioration of the Akt-dependent cell survival pathway suggest it could be used to treat emphysema patients. However, more detailed studies are needed.</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Authors’ Contribution</span><p id="par0130" class="elsevierStylePara elsevierViewall">Jai Prakash Muyal participated in the design of the study and performed animal model preparation, statistical analysis, supervised the work and helped draft the manuscript. Dhananjay Kumar carried out RNA isolation from lung tissues, cDNA synthesis and quantitative PCR. Sudhir Kotnala carried out Histopathology, Destructive Index and Western blotting. Vandana Muyal contributed to western blot and manuscript preparation. Amit K Tyagi helped to provide and prepare different animal models.</p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0150">Conflict of Interest</span><p id="par0135" class="elsevierStylePara elsevierViewall">The authors declare they have no conflict of interest directly or indirectly related to the manuscript contents.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:12 [ 0 => array:3 [ "identificador" => "xres526631" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results and discussion" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec546868" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres526630" "titulo" => "Resumen" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados y discusión" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusión" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec546867" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and Methods" "secciones" => array:7 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Animal Model Preparation" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Lung Fixation" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Morphometry" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Isolation of Total RNA from the Left Lung Tissue and cDNA Synthesis" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "Relative mRNA Quantification" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Protein Isolation and Western Blotting for VEGF" ] 6 => array:2 [ "identificador" => "sec0045" "titulo" => "Statistical Analysis of Relative mRNA Quantification" ] ] ] 6 => array:3 [ "identificador" => "sec0050" "titulo" => "Results" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "sec0055" "titulo" => "Effects of rHuKGF on Tissue Architecture" ] 1 => array:2 [ "identificador" => "sec0060" "titulo" => "Effects of rHuKGF on VEGF, VEGFR, PI3K, and Akt" ] 2 => array:2 [ "identificador" => "sec0065" "titulo" => "Effects of rHuKGF on Akt Pathway Antagonists" ] 3 => array:2 [ "identificador" => "sec0070" "titulo" => "Effects of rHuKGF on Apoptotic Markers" ] ] ] 7 => array:2 [ "identificador" => "sec0075" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "sec0080" "titulo" => "Conclusion" ] 9 => array:2 [ "identificador" => "sec0085" "titulo" => "Authors’ Contribution" ] 10 => array:2 [ "identificador" => "sec0090" "titulo" => "Conflict of Interest" ] 11 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2014-01-04" "fechaAceptado" => "2014-04-29" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec546868" "palabras" => array:4 [ 0 => "Emphysema" 1 => "Recombinant human keratinocyte growth factor" 2 => "Akt pathway" 3 => "Quantitative PCR analysis" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec546867" "palabras" => array:4 [ 0 => "Enfisema" 1 => "Factor de crecimiento queratinocítico humano recombinante" 2 => "Vía de Akt" 3 => "Análisis de PCR cuantitativa" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Introduction</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Emphysema has been associated with decreased VEGF and VEGFR-2 expression and the presence of high numbers of apoptotic alveolar cells. Keratinocyte growth factor stimulates VEGF synthesis which in turn confers normal lung structure maintenance via the Akt pathway. In this study the potential role of rHuKGF in the improvement of deregulated Akt mediated cell survival pathway in emphysematous mice was investigated.</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Three experimental groups, i.e., emphysema, treatment and control groups, were prepared. Lungs of mice were treated on 3 occasions by oropharyngeal instillation of 10<span class="elsevierStyleHsp" style=""></span>mg rHuKGF per kg body weight after induction of emphysema with porcine pancreatic elastase. Subsequently, lung tissues from mice were collected for histopathology and molecular biology studies.</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results and discussion</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Histopathology photomicrographs and destructive index analysis have shown that elastase-induced airspace enlargement and loss of alveoli recovered in the treatment group. rHuKGF stimulates VEGF production which in turn induces the Akt mediated cell survival pathway in emphysematous lungs. mRNA expression of VEGF, VEGFR, PI3K and Akt was significantly increased while Pten, Caspase-9 and Bad was notably decreased in treatment group when compared with emphysema group, being comparable with the control group. Moreover, VEGF protein expression was in accordance with that found for mRNA.</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusion</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Therapeutic rHuKGF supplementation improves the deregulated Akt pathway in emphysema, resulting in alveolar cell survival through activation of the endogenous VEGF-dependent cell survival pathway. Hence rHuKGF may prove to be a potential drug in the treatment of emphysema.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Introduction" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results and discussion" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Introducción</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">El enfisema se ha asociado a una disminución de la expresión de VEGF y VEGFR-2 y a la presencia de un número elevado de células alveolares apoptósicas. El factor de crecimiento queratinocítico estimula la síntesis de VEGF, lo cual proporciona, a su vez, un mantenimiento de la estructura pulmonar normal a través de la vía de Akt. En este estudio hemos investigado el posible papel del rHuKGF en la mejora de la falta de regulación de la vía de supervivencia celular mediada por Akt en ratones enfisematosos.</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Métodos</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Se establecieron 3 grupos experimentales: grupos de enfisema, tratamiento y control. Los pulmones de los ratones se trataron terapéuticamente en 3 ocasiones mediante la instilación orofaríngea de 10<span class="elsevierStyleHsp" style=""></span>mg de rHuKGF/kg de peso corporal tras la inducción del enfisema mediante elastasa pancreática porcina. Posteriormente, se obtuvo tejido pulmonar de los ratones para la realización de exámenes de histopatología y biología molecular.</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados y discusión</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Las microfotografías de histopatología y el análisis del índice de destrucción han mostrado que el agrandamiento del espacio aéreo inducido por la elastasa y la pérdida de alvéolos se recuperaron en el grupo de tratamiento. El rHuKGF estimula la producción de VEGF, que a su vez induce la vía de supervivencia celular mediada por Akt en los pulmones enfisematosos. Se produjo un aumento significativo de la expresión de mRNA de VEGF, VEGFR, PI3K y Akt, mientras que hubo una disminución notable de Pten, caspasa-9 y Bad en el grupo de tratamiento en comparación con el grupo de enfisema, y los resultados fueron comparables a los del grupo de control. Además, la expresión de VEGF a nivel proteico concordaba con la observada a nivel de mRNA.</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusión</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Los suplementos terapéuticos de rHuKGF mejoran la mala regulación de la vía de Akt en el trastorno del enfisema, dando lugar a una supervivencia celular alveolar a través de una activación de la vía de la supervivencia celular dependiente de VEGF endógena. Así pues, el rHuKGF podría ser un posible fármaco para el tratamiento del enfisema.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Introducción" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados y discusión" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusión" ] ] ] ] "NotaPie" => array:1 [ 0 => array:2 [ "etiqueta" => "☆" "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Please cite this article as: Prakash Muyal J, Kumar D, Kotnala S, Muyal V, Tyagi AK. El factor de crecimiento queratinocítico humano recombinante induce la progresión de la supervivencia celular mediada por Akt en ratones enfisematosos. Arch Bronconeumol. 2015;51:328–337.</p>" ] ] "multimedia" => array:7 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1780 "Ancho" => 2664 "Tamanyo" => 361468 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Hypothesised mechanism of rHuKGF induced Akt-mediated survival signalling in emphysematous condition. Elastase-induced emphysema decreases vascular endothelial growth factor (VEGF) and VEGFR2 levels, thereby altering survival signalling via PI-3K/Akt. Growth factors (such as VEGF, KGF etc.) and survival factors activate receptors that recruit PI3K to the membrane, which in turn activates the kinase Akt. The antagonist PTEN suppresses cell survival by down-regulating (shown by down arrow) the Akt pathway through dephosphorylation. Akt phosphorylates and compromises the function of caspase-9 and Bad, proteins involved in cell death pathways. The hypothesis here shows the deregulation of Akt Mediated Cell Survival in elastase induced emphysema group (X). Various molecules, such as several growth factors, are known to play a key role in lung repair, development, and cell survival. In this case, rHuKGF supplementation (Y) is thought to induce the Akt-Mediated Cell Survival pathway in emphysema, and should be identical to the healthy group (Z). VEGF=vascular endothelial growth factor; VEGFR2=VEGF receptor; PI3K=Phosphatidylinositide-3′-OH kinase; Akt=Ak-mouse strain; t-thymoma; PTEN=Phosphatase and Tensin homolog on chromosome 10; Bad=Bcl-2-associated death promoter.</p>" ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1663 "Ancho" => 2469 "Tamanyo" => 204013 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Schematic outline of the experimental setup. On day 0 and day 10, mice received an oropharyngeal instillation of 40<span class="elsevierStyleHsp" style=""></span>μl of saline with or without porcine pancreatic elastase (2.5<span class="elsevierStyleHsp" style=""></span>mg/kg body weight). On day 31, 34 and 37, animals received an oropharyngeal instillation of 40<span class="elsevierStyleHsp" style=""></span>μl of saline or with rHuKGF (10<span class="elsevierStyleHsp" style=""></span>mg/kg body weight). At day 40, animals were sacrificed and lungs removed for analysis by histopathology and molecular biology. ES=Elastase–saline (emphysema group); SS=Saline–saline (healthy group); EK=Elastase–rHuKGF (therapy group).</p>" ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2832 "Ancho" => 2223 "Tamanyo" => 503878 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">(I) Histopathology of gas exchange area. Haematoxylin and Eosin staining tissue sections show (A) normal histology in control lungs, (B) rarefaction of alveolar septa with enlarged airspaces in emphysema lungs, and (C) increased airspaces with thickened alveolar septa in therapy lungs. All micrographs were taken at identical magnification. Determination of Destructive Index, a transparent sheet with 80 equally distributed points, is laid over the printed digitised image of a HE-stained section (D, E, F). The area surrounding each dot is determined according the criteria described in the ‘Methods’ section. (II) Statistical analysis of the Destructive Index. In contrast to the healthy group (SS), significant increase in percentage Destructive Index was seen in f emphysematous lungs (ES), while the same was reduced upon supplementation of rHuKGF in emphysematous lungs (EK). Graphs indicate mean values with standard deviation. Data were analysed by means of unpaired <span class="elsevierStyleItalic">t</span>-test to test for the effect of rHuKGF and elastase, respectively (<a class="elsevierStyleCrossRef" href="#fig0030">Fig. 6</a>I). ES=Elastase–saline (emphysema group); SS=Saline–saline (healthy group); EK=Elastase–rHuKGF (therapy group). *<span class="elsevierStyleItalic">P</span><.05 versus the respective control group.</p>" ] ] 3 => array:7 [ "identificador" => "fig0020" "etiqueta" => "Fig. 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 3635 "Ancho" => 2597 "Tamanyo" => 303201 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">(I) Relative mRNA expression of VEGF, VEGFR2, PI3K and Akt (A–D) in whole lung tissue. VEGF, VEGFR2, PI3K and Akt were significantly more down-regulated in the emphysema group (ES) than the control group (SS). In contrast, VEGF, VEGFR2, PI3K and Akt were significantly up-regulated in the therapy group (EK) and were comparable with the control group. The mRNA levels of the target genes were determined relative to the endogenous reference gene β-actin according to the formula 2 to the power of delta cycle threshold (2ΔCt), where ΔCt=Ct, reference gene–Ct, target gene. (II) Densitometry analysis of VEGF Western blot. Densitometry of VEGF western blot revealed a similar pattern as that observed at the mRNA level (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>II). Graphs indicate mean values with standard deviation. Data were analysed by means of unpaired <span class="elsevierStyleItalic">t</span>-test to test for the effect of rHuKGF and elastase, respectively. ES=Elastase–saline (emphysema group); SS=Saline–saline (healthy group); EK=Elastase–rHuKGF (therapy group). *<span class="elsevierStyleItalic">P</span><.05 and **<span class="elsevierStyleItalic">P</span><.01 versus the respective control group.</p>" ] ] 4 => array:7 [ "identificador" => "fig0025" "etiqueta" => "Fig. 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 1174 "Ancho" => 1617 "Tamanyo" => 51753 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Relative mRNA expression of Akt pathway antagonist (PTEN) in whole lung tissue. The expression level of PTEN was significantly induced in elastase-challenged lungs in contrast to the therapy group. In the therapy group there was a significant decrease in PTEN expression levels, and these were comparable to control. The mRNA levels of the target genes were determined relative to the endogenous reference gene β-actin according to the formula 2 to the power of delta cycle threshold (2ΔCt), where ΔCt=Ct, reference gene–Ct, target gene. Graphs indicate mean values with standard deviation. Data were analysed by means of unpaired <span class="elsevierStyleItalic">t</span>-test to test for the effect of rHuKGF and elastase, respectively. ES=Elastase–Saline (emphysema group); SS=Saline–Saline (healthy group); EK=Elastase–rHuKGF (therapy group). *<span class="elsevierStyleItalic">P</span><.05 versus the respective control group.</p>" ] ] 5 => array:7 [ "identificador" => "fig0030" "etiqueta" => "Fig. 6" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr6.jpeg" "Alto" => 928 "Ancho" => 2225 "Tamanyo" => 99617 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Relative mRNA expression of apoptotic markers (Caspase-9 and Bad) in whole lung tissue. The expression level of Caspase-9 and Bad were significantly induced in elastase-challenged lungs in contrast to the therapy group. In the therapy group there was a significant decrease in Caspase-9 and Bad expression levels, and these were comparable to control. The mRNA levels of the target genes were determined relative to the endogenous reference gene β-actin according to the formula 2 to the power of delta cycle threshold (2ΔCt), where ΔCt=Ct, reference gene–Ct, target gene. Graphs indicate mean values with standard deviation. Data were analysed by means of unpaired <span class="elsevierStyleItalic">t</span>-test to test for the effect of rHuKGF and elastase, respectively. ES=Elastase–Saline (emphysema group); SS=Saline–Saline (healthy group); EK=Elastase–rHuKGF (therapy group). *<span class="elsevierStyleItalic">P</span><.05 versus the respective control group.</p>" ] ] 6 => array:7 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "<p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">VEGF=vascular endothelial growth factor; VEGFR2=VEGF receptor; PI3K=Phosphatidylinositide-3′-OH kinase; Akt=Ak–mouse strain; t-thymoma; Pten=Phosphatase and Tensin homolog on chromosome 10; Bad=Bcl-2-associated death promoter.</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Gene name \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Left primer [5′–3′] \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Right primer [5′–3′] \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Amplicon length (bp) \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">VEGFA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">CAGGCTGCTGTAACGATGAA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">GCATTCACATCTGCTGTGCT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">140 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">VEGFR2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">ACCAAGGCGACTATGTTTGC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">GGGCAAGTCACTTCAATGGT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">160 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">PI3K \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">CAAAGCGGAGAACCTATTGC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">CCGGTGGCAGTCTTGTTAAT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">138 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">Akt1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">GTGAAAGAGAAGGCCACAGG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">GTCGTGGGTCTGGAATGAGT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">165 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">Pten \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">AGACCATAACCCACCACAGC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">TACACCAGTCCGTCCCTTTC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">127 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">Caspase9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">GATGCTGTCCCCTATCAGGA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">CGATGTACCAGGAGCCACTT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">151 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="table-entry " align="left" valign="top">Bad \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">GGAGCTTAGCCCTTTTCGAG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">GCTTTGTCGCATCTGTGTTG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">166 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab848513.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Primer Details: Sequence and Amplicon Size of Target Sequences.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:56 [ 0 => array:3 [ "identificador" => "bib0285" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The impact of COPD in lung health worldwide: epidemiology and incidence" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "S. Hurd" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Chest" "fecha" => "2000" "volumen" => "117" "paginaInicial" => "1S" "paginaFinal" => "4S" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10673465" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0290" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A stimulating treatment for emphysema" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "J.C. Hogg" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Nat Med" "fecha" => "1997" "volumen" => "3" "paginaInicial" => "603" "paginaFinal" => "605" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9176480" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0295" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratinocyte growth factor is a growth factor for type II pneumocytes in vivo" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "T.R. Ulich" 1 => "E.S. Yi" 2 => "K. Longmuir" 3 => "S. Yin" 4 => "R. Biltz" 5 => "C.F. Morris" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI117086" "Revista" => array:6 [ "tituloSerie" => "J Clin Investig" "fecha" => "1994" "volumen" => "93" "paginaInicial" => "1298" "paginaFinal" => "1306" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8132770" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0300" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Toward therapeutic pulmonary alveolar regeneration in humans" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "D. Massaro" 1 => "G.D. Massaro" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1513/pats.200605-127SF" "Revista" => array:6 [ "tituloSerie" => "Proc Am Thorac Soc" "fecha" => "2006" "volumen" => "3" "paginaInicial" => "709" "paginaFinal" => "712" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17065378" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0305" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular pathogenesis of emphysema" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "S.L. Taraseviciene" 1 => "N.F. Voelkel" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI31811" "Revista" => array:6 [ "tituloSerie" => "J Clin Investig" "fecha" => "2008" "volumen" => "118" "paginaInicial" => "394" "paginaFinal" => "402" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18246188" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0310" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Lung volume reduction surgery for emphysema: out on a limb without a NETT" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "J.P. Utz" 1 => "R.D. Hubmayr" 2 => "C. Deschamps" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4065/73.6.552" "Revista" => array:6 [ "tituloSerie" => "Mayo Clin Proc" "fecha" => "1998" "volumen" => "73" "paginaInicial" => "552" "paginaFinal" => "566" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9621865" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0315" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Human keratinocyte growth factor effects in a porcine model of epidermal wound healing" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C.L. Staiano" 1 => "J.G. Krueger" 2 => "J.S. Rubin" 3 => "S. D’Limi" 4 => "V.P. Vallat" 5 => "L. Valentino" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Exp Med" "fecha" => "1993" "volumen" => "178" "paginaInicial" => "865" "paginaFinal" => "878" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8350059" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0320" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratinocyte growth factor accelerates corneal epithelial wound healing in vivo" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "C. Sotozono" 1 => "T. Inatomi" 2 => "M. Nakamura" 3 => "S. Kinoshita" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Investig Ophthalmol Vis Sci" "fecha" => "1995" "volumen" => "36" "paginaInicial" => "1524" "paginaFinal" => "1529" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0325" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratinocyte growth factor ameliorates mucosal injury in an experimental model of colitis in rats" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.M. Zeeh" 1 => "F. Procaccino" 2 => "P. Hoffmann" 3 => "S.L. Aukerman" 4 => "J.A. McRoberts" 5 => "S. Soltani" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Gastroenterology" "fecha" => "1996" "volumen" => "110" "paginaInicial" => "1077" "paginaFinal" => "1083" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8612996" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0330" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratinocyte and hepatocyte growth factors in the lung: roles in lung development, inflammation, and repair" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "L.B. Ware" 1 => "M.A. Matthay" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/ajplung.00439.2001" "Revista" => array:6 [ "tituloSerie" => "Am J Physiol Lung Cell Mol Physiol" "fecha" => "2002" "volumen" => "282" "paginaInicial" => "L924" "paginaFinal" => "L940" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11943656" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0335" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Intratracheal instillation of KGF decreases hyperoxia-induced mortality in rats" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "R.J. Panos" 1 => "P.M. Bak" 2 => "W.S. Simone" 3 => "J.S. Rubin" 4 => "L.J. Smith" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI118250" "Revista" => array:6 [ "tituloSerie" => "J Clin Investig" "fecha" => "1995" "volumen" => "96" "paginaInicial" => "2026" "paginaFinal" => "2033" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7560096" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0340" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prevention of bleomycin-induced lung injury in rats by keratinocyte growth factor" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R.R. Deterding" 1 => "A.M. Havill" 2 => "T. Yano" 3 => "S.C. Middleton" 4 => "C.R. Jacoby" 5 => "J.M. Shannon" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Proc Assoc Am Phys" "fecha" => "1997" "volumen" => "109" "paginaInicial" => "254" "paginaFinal" => "268" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9154642" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0345" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Double intratracheal instillation of keratinocyte growth factor prevents bleomycin-induced lung fibrosis in rats" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "K. Sugahara" 1 => "K. Iyama" 2 => "M.J. Kuroda" 3 => "K. Sano" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/(SICI)1096-9896(199809)186:1<90::AID-PATH137>3.0.CO;2-X" "Revista" => array:6 [ "tituloSerie" => "J Pathol" "fecha" => "1998" "volumen" => "186" "paginaInicial" => "90" "paginaFinal" => "98" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9875145" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0350" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratinocyte growth factor protects against Pseudomonas aeruginosa-induced lung injury" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "N.B. Viget" 1 => "B.P.H. Guery" 2 => "F. Ader" 3 => "R. Neviere" 4 => "S. Alfandari" 5 => "C. Creuzy" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Am J Physiol Lung Cell Mol Physiol" "fecha" => "2000" "volumen" => "279" "paginaInicial" => "L1199" "paginaFinal" => "L1209" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11076810" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0355" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratinocyte growth factor reduces lung damage due to acid instillation in rats" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "T. Yano" 1 => "R.R. Deterding" 2 => "W.S. Simonet" 3 => "J.M. Shannon" 4 => "R.J. Mason" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1165/ajrcmb.15.4.8879176" "Revista" => array:6 [ "tituloSerie" => "Am J Respir Cell Mol Biol" "fecha" => "1996" "volumen" => "15" "paginaInicial" => "433" "paginaFinal" => "442" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8879176" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0360" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratinocyte growth factor pretreatment is associated with decreased MIP-2 concentrations and reduced neutrophil recruitment in acid aspiration lung injury" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J.A. Nemzek" 1 => "S.J. Ebong" 2 => "J. Kim" 3 => "G.L. Bolgos" 4 => "D.G. Remick" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Shock" "fecha" => "2002" "volumen" => "18" "paginaInicial" => "501" "paginaFinal" => "506" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12462556" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0365" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratinocyte growth factor therapy in murine oleic acid-induced acute lung injury" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "K. Ulrich" 1 => "M. Stern" 2 => "M.E. Goddard" 3 => "J. Williams" 4 => "J. Zhu" 5 => "A. Dewar" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/ajplung.00450.2004" "Revista" => array:6 [ "tituloSerie" => "Am J Physiol Lung Cell Mol Physiol" "fecha" => "2005" "volumen" => "288" "paginaInicial" => "L1179" "paginaFinal" => "L1192" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15681392" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0370" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratinocyte growth factor ameliorates radiation- and bleomycin-induced lung injury and mortality" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "E.S. Yi" 1 => "S.T. Williams" 2 => "H. Lee" 3 => "D.M. Malicki" 4 => "E.M. Chin" 5 => "S. Yin" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Am J Pathol" "fecha" => "1996" "volumen" => "149" "paginaInicial" => "1963" "paginaFinal" => "1970" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8952531" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0375" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Allogeneic human mesenchymal stem cells for treatment of <span class="elsevierStyleItalic">E. coli</span> endotoxin-induced acute lung injury in the ex vivo perfused human lung" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J.W. Lee" 1 => "X. Fang" 2 => "N. Gupta" 3 => "V. Serikov" 4 => "M.A. Matthay" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1073/pnas.0907996106" "Revista" => array:6 [ "tituloSerie" => "Proc Natl Acad Sci USA" "fecha" => "2009" "volumen" => "106" "paginaInicial" => "16357" "paginaFinal" => "16362" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19721001" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0380" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Palifermin induces alveolar maintenance programs in emphysematous mice" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A.O. Yildirim" 1 => "V. Muyal" 2 => "G. John" 3 => "B. Müller" 4 => "C. Seifart" 5 => "M. Kasper" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1164/rccm.200804-573OC" "Revista" => array:6 [ "tituloSerie" => "Am J Respir Crit Care Med" "fecha" => "2010" "volumen" => "181" "paginaInicial" => "705" "paginaFinal" => "717" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20007933" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0385" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The biology of VEGF and its receptors" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "N. Ferrara" 1 => "H.P. Gerber" 2 => "J. LeCouter" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/nm0603-669" "Revista" => array:6 [ "tituloSerie" => "Nat Med" "fecha" => "2003" "volumen" => "9" "paginaInicial" => "669" "paginaFinal" => "676" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12778165" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0390" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Vascular endothelial growth factor (VEGF) and its receptors" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "G. Neufeld" 1 => "T. Cohen" 2 => "S. Gengrinovitch" 3 => "Z. Poltorak" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "FASEB J" "fecha" => "1999" "volumen" => "13" "paginaInicial" => "9" "paginaFinal" => "22" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9872925" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0395" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Regulation of vascular endothelial growth factor expression in cultured keratinocytes. Implications for normal and impaired wound healing" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "S. Frank" 1 => "G. Hübner" 2 => "G. Breier" 3 => "M.T. Longaker" 4 => "D.G. Greenhalgh" 5 => "S. Werner" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Biol Chem" "fecha" => "1995" "volumen" => "270" "paginaInicial" => "12607" "paginaFinal" => "12613" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7759509" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0400" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Biology of vascular endothelial growth factors" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "H. Roy" 1 => "S. Bhardwaj" 2 => "S. Ylä-Herttuala" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.febslet.2006.03.087" "Revista" => array:6 [ "tituloSerie" => "FEBS Lett" "fecha" => "2006" "volumen" => "580" "paginaInicial" => "2879" "paginaFinal" => "2887" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16631753" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0405" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Angiogenesis by fibroblast growth factor-4 is mediated through an autocrine up-regulation of vascular endothelial growth factor expression" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "C.F. Deroanne" 1 => "A. Hajitou" 2 => "C.M. Calberg-Bacq" 3 => "B.V. Nusgens" 4 => "C.M. Lapiere" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Cancer Res" "fecha" => "1997" "volumen" => "57" "paginaInicial" => "5590" "paginaFinal" => "5597" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9407972" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0410" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Regulation of vascular endothelial growth factor expression in cultured keratinocytes – implications for normal and impaired wound healing" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "S. Frank" 1 => "G. Hubner" 2 => "G. Breier" 3 => "M.T. Longaker" 4 => "D.G. Greenhalgh" 5 => "S. Werner" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Biol Chem" "fecha" => "1995" "volumen" => "270" "paginaInicial" => "12607" "paginaFinal" => "12613" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7759509" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0415" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Sp1 recognition sites in the proximal promoter of the human vascular endothelial growth factor gene are essential for platelet-derived growth factor-induced gene expression" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "G. Finkenzeller" 1 => "A. Sparacio" 2 => "A. Technau" 3 => "D. Marme" 4 => "G. Siemeister" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.onc.1201219" "Revista" => array:6 [ "tituloSerie" => "Oncogene" "fecha" => "1997" "volumen" => "15" "paginaInicial" => "669" "paginaFinal" => "676" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9264407" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0420" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Vascular endothelial growth factor is induced in response to transforming growth factor-beta in fibroblastic and epithelial cells" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L. Pertovaara" 1 => "A. Kaipainen" 2 => "T. Mustonen" 3 => "A. Orpana" 4 => "N. Ferrara" 5 => "O. Saksela" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Biol Chem" "fecha" => "1994" "volumen" => "269" "paginaInicial" => "6271" "paginaFinal" => "6274" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8119973" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0425" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Akt mediates cytoprotection of endothelial cells by vascular endothelial growth factor in an anchorage-dependent manner" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Y. Fujio" 1 => "K. Walsh" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Biol Chem" "fecha" => "1999" "volumen" => "274" "paginaInicial" => "16349" "paginaFinal" => "16354" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10347193" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0430" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "PI3K-AKT pathway mediates growth and survival signals during development of fetal mouse lung" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "J. Wang" 1 => "T. Ito" 2 => "N. Udaka" 3 => "K. Okudela" 4 => "T. Yazawa" 5 => "H. Kitamura" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.tice.2004.09.002" "Revista" => array:6 [ "tituloSerie" => "Tissue Cell" "fecha" => "2005" "volumen" => "37" "paginaInicial" => "25" "paginaFinal" => "35" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15695173" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0435" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Do different branching epithelia use a conserved developmental mechanism?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "J.A. Davies" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/bies.10161" "Revista" => array:6 [ "tituloSerie" => "Bioessays" "fecha" => "2002" "volumen" => "24" "paginaInicial" => "937" "paginaFinal" => "948" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12325126" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0440" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Destructive Index: a measurement of lung parenchymal destruction in smokers" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Saetta" 1 => "R.J. Shiner" 2 => "G.E. Angus" 3 => "W.D. Kim" 4 => "N.S. Wang" 5 => "M. King" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1164/arrd.1985.131.5.764" "Revista" => array:6 [ "tituloSerie" => "Am Rev Respir Dis" "fecha" => "1985" "volumen" => "131" "paginaInicial" => "764" "paginaFinal" => "769" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/4003921" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0445" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Morphological quantification of emphysema in small human lung specimens: comparison of methods and relation with clinical data" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A.A. Robbesom" 1 => "E.M. Versteeg" 2 => "J.H. Veerkamp" 3 => "J.H. van Krieken" 4 => "H.J. Bulten" 5 => "H.T. Smits" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Modern Pathol" "fecha" => "2003" "volumen" => "16" "paginaInicial" => "1" "paginaFinal" => "7" ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0450" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Systematic comparison of RNA extraction techniques from frozen and fresh lung tissues: checkpoint towards gene expression studies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J.P. Muyal" 1 => "V. Muyal" 2 => "B.P. Kaistha" 3 => "C. Seifart" 4 => "H. Fehrenbach" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/1746-1596-4-9" "Revista" => array:5 [ "tituloSerie" => "Diagn Pathol" "fecha" => "2009" "volumen" => "4" "paginaInicial" => "9" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19317905" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0455" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "VEGFR-2 inhibition augments cigarette smoke-induced oxidative stress and inflammatory responses leading to endothelial dysfunction" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "I. Edirisinghe" 1 => "S.R. Yang" 2 => "H. Yao" 3 => "S. Rajendrasozhan" 4 => "S. Caito" 5 => "D. Adenuga" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1096/fj.07-099481" "Revista" => array:6 [ "tituloSerie" => "FASEB J" "fecha" => "2008" "volumen" => "22" "paginaInicial" => "2297" "paginaFinal" => "2310" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18263699" "web" => "Medline" ] ] ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0460" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratinocyte growth factor protects against elastase-induced pulmonary emphysema in mice" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L. Plantier" 1 => "S. Marchand-Adam" 2 => "V.G. Antico Arciuch" 3 => "L. Boyer" 4 => "C. De Coster" 5 => "J. Marchal" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/ajplung.00460.2006" "Revista" => array:6 [ "tituloSerie" => "Am J Physiol Lung Cell Mol Physiol" "fecha" => "2007" "volumen" => "293" "paginaInicial" => "L1230" "paginaFinal" => "L1239" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17766584" "web" => "Medline" ] ] ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0465" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of Akt signaling in vascular homeostasis and angiogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "I. Shiojima" 1 => "K. Walsh" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Circ Res" "fecha" => "2002" "volumen" => "90" "paginaInicial" => "1243" "paginaFinal" => "1250" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12089061" "web" => "Medline" ] ] ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0470" "etiqueta" => "38" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The function of KGF in morphogenesis of epithelium and reepithelialization of wounds" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Werner" 1 => "H. Smola" 2 => "X. Liao" 3 => "M.T. Longaker" 4 => "T. Krieg" 5 => "P.H. Hofschneider" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Science" "fecha" => "1994" "volumen" => "266" "paginaInicial" => "819" "paginaFinal" => "822" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7973639" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0475" "etiqueta" => "39" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratinocyte growth factor preserves normal thymopoiesis and thymic microenvironment during experimental graft-versus-host disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Rossi" 1 => "B.R. Blazar" 2 => "C.L. Farrell" 3 => "D.M. Danilenko" 4 => "D.L. Lacey" 5 => "K.I. Weinberg" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Blood" "fecha" => "2002" "volumen" => "100" "paginaInicial" => "682" "paginaFinal" => "691" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12091365" "web" => "Medline" ] ] ] ] ] ] ] ] 39 => array:3 [ "identificador" => "bib0480" "etiqueta" => "40" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Inducible expression of keratinocyte growth factor (KGF) in mice inhibits lung epithelial cell death induced by hyperoxia" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "P. Ray" 1 => "Y. Devaux" 2 => "D.B. Stolz" 3 => "M. Yarlagadda" 4 => "S.C. Watkins" 5 => "Y. Lu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1073/pnas.2534397100" "Revista" => array:4 [ "tituloSerie" => "Proc Natl Acad Sci USA" "fecha" => "2003" "volumen" => "100" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14673118" "web" => "Medline" ] ] ] ] ] ] ] ] 40 => array:3 [ "identificador" => "bib0485" "etiqueta" => "41" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Akt down-regulation of p38 signaling provides a novel mechanism of vascular endothelial growth factor-mediated cytoprotection in endothelial cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "J.P. Gratton" 1 => "M. Morales-Ruiz" 2 => "Y. Kureishi" 3 => "D. Fulton" 4 => "K. Walsh" 5 => "W.C. Sessa" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M105392200" "Revista" => array:4 [ "tituloSerie" => "J Biol Chem" "fecha" => "2001" "volumen" => "276" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11606570" "web" => "Medline" ] ] ] ] ] ] ] ] 41 => array:3 [ "identificador" => "bib0490" "etiqueta" => "42" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cigarette smoke disrupts VEGF165-VEGFR-2 receptor signaling complex in rat lungs and patients with COPD: morphological impact of VEGFR-2 inhibition" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.A. Marwick" 1 => "C.S. Stevenson" 2 => "J. Giddings" 3 => "W. MacNee" 4 => "K. Butler" 5 => "I. Rahman" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/ajplung.00116.2005" "Revista" => array:6 [ "tituloSerie" => "Am J Physiol Lung Cell Mol Physiol" "fecha" => "2006" "volumen" => "290" "paginaInicial" => "L897" "paginaFinal" => "L908" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16361360" "web" => "Medline" ] ] ] ] ] ] ] ] 42 => array:3 [ "identificador" => "bib0495" "etiqueta" => "43" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Targeted induction of lung endothelial cell apoptosis causes emphysema-like changes in the mouse" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R.J. Giordano" 1 => "J. Lahdenranta" 2 => "L. Zhen" 3 => "U. Chukwueke" 4 => "I. Petrache" 5 => "R.R. Langley" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1074/jbc.M804595200" "Revista" => array:6 [ "tituloSerie" => "J Biol Chem" "fecha" => "2008" "volumen" => "283" "paginaInicial" => "29447" "paginaFinal" => "29460" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18718906" "web" => "Medline" ] ] ] ] ] ] ] ] 43 => array:3 [ "identificador" => "bib0500" "etiqueta" => "44" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A novel antiapoptotic role for alpha1-antitrypsin in the prevention of pulmonary emphysema" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "I. Petrache" 1 => "I. Fijalkowska" 2 => "L. Zhen" 3 => "T.R. Medler" 4 => "E. Brown" 5 => "P. Cruz" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1164/rccm.200512-1842OC" "Revista" => array:6 [ "tituloSerie" => "Am J Respir Crit Care Med" "fecha" => "2006" "volumen" => "173" "paginaInicial" => "1222" "paginaFinal" => "1228" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16514110" "web" => "Medline" ] ] ] ] ] ] ] ] 44 => array:3 [ "identificador" => "bib0505" "etiqueta" => "45" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Lung-targeted VEGF inactivation leads to an emphysema phenotype in mice" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "K. Tang" 1 => "H.B. Rossiter" 2 => "P.D. Wagner" 3 => "E.C. Breen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/japplphysiol.00221.2004" "Revista" => array:6 [ "tituloSerie" => "J Appl Physiol" "fecha" => "2004" "volumen" => "97" "paginaInicial" => "1559" "paginaFinal" => "1566" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15208295" "web" => "Medline" ] ] ] ] ] ] ] ] 45 => array:3 [ "identificador" => "bib0510" "etiqueta" => "46" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Endothelial cell death and decreased expression of vascular endothelial growth factor and vascular endothelial growth factor receptor 2 in emphysema" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Y. Kasahara" 1 => "R.M. Tuder" 2 => "C.D. Cool" 3 => "D.A. Lynch" 4 => "S.C. Flores" 5 => "N.F. Voelkel" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1164/ajrccm.163.3.2002117" "Revista" => array:6 [ "tituloSerie" => "Am J Respir Crit Care Med" "fecha" => "2001" "volumen" => "163" "paginaInicial" => "737" "paginaFinal" => "744" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11254533" "web" => "Medline" ] ] ] ] ] ] ] ] 46 => array:3 [ "identificador" => "bib0515" "etiqueta" => "47" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The role of phosphatidylinositol 3-kinase in vascular endothelial growth factor signaling" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "G.D. Thakker" 1 => "D.P. Hajjar" 2 => "W.A. Muller" 3 => "T.K. Rosengart" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Biol Chem" "fecha" => "1999" "volumen" => "274" "paginaInicial" => "10002" "paginaFinal" => "10007" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10187776" "web" => "Medline" ] ] ] ] ] ] ] ] 47 => array:3 [ "identificador" => "bib0520" "etiqueta" => "48" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Keratinocyte growth factor induces Akt kinase activity and inhibits Fas-mediated apoptosis in A549 lung epithelial cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "B. Shenying" 1 => "W. Yijie" 2 => "S. Patricia" 3 => "C. Alpana" 4 => "I.D. Andrea" 5 => "Clay" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/ajplung.00309.2003" "Revista" => array:6 [ "tituloSerie" => "Am J Physiol Lung Cell Mol Physiol" "fecha" => "2005" "volumen" => "288" "paginaInicial" => "L36" "paginaFinal" => "L42" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15347568" "web" => "Medline" ] ] ] ] ] ] ] ] 48 => array:3 [ "identificador" => "bib0525" "etiqueta" => "49" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "PTEN identified as important risk factor of chronic obstructive pulmonary disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "H.D. Hosgood" 1 => "M. Idan" 2 => "H. Xingzhou" 3 => "C. Stephen" 4 => "L. Qing" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.rmed.2009.06.016" "Revista" => array:6 [ "tituloSerie" => "Respir Med" "fecha" => "2009" "volumen" => "103" "paginaInicial" => "1866" "paginaFinal" => "1870" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19625176" "web" => "Medline" ] ] ] ] ] ] ] ] 49 => array:3 [ "identificador" => "bib0530" "etiqueta" => "50" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "PTEN overexpression suppresses proliferation and differentiation and enhances apoptosis of the mouse mammary epithelium" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "D. Joëlle" 1 => "P.R. Jean" 2 => "S. Moshe" 3 => "H. Lothar" 4 => "L. Derek" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI13829" "Revista" => array:6 [ "tituloSerie" => "J Clin Investig" "fecha" => "2002" "volumen" => "110" "paginaInicial" => "815" "paginaFinal" => "825" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12235113" "web" => "Medline" ] ] ] ] ] ] ] ] 50 => array:3 [ "identificador" => "bib0535" "etiqueta" => "51" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Overexpression of caspase-9 triggers its activation and apoptosis in vitro" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "D. Mirjam" 1 => "Š. Dušan" 2 => "M. Irina" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Croat Med J" "fecha" => "2006" "volumen" => "47" "paginaInicial" => "832" "paginaFinal" => "840" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17167855" "web" => "Medline" ] ] ] ] ] ] ] ] 51 => array:3 [ "identificador" => "bib0540" "etiqueta" => "52" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The Bcl-2 protein family: arbiters of cell survival" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "J.M. Adams" 1 => "S. Cory" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Science" "fecha" => "1998" "volumen" => "281" "paginaInicial" => "1322" "paginaFinal" => "1326" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9735050" "web" => "Medline" ] ] ] ] ] ] ] ] 52 => array:3 [ "identificador" => "bib0545" "etiqueta" => "53" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "J. Zha" 1 => "H. Harada" 2 => "E. Yang" 3 => "J. Jockel" 4 => "S.J. Korsmeyer" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Cell" "fecha" => "1996" "volumen" => "87" "paginaInicial" => "619" "paginaFinal" => "628" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8929531" "web" => "Medline" ] ] ] ] ] ] ] ] 53 => array:3 [ "identificador" => "bib0550" "etiqueta" => "54" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S.R. Datta" 1 => "H. Dudek" 2 => "X. Tao" 3 => "S. Masters" 4 => "H. Fu" 5 => "Y. Gotoh" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Cell" "fecha" => "1997" "volumen" => "91" "paginaInicial" => "231" "paginaFinal" => "241" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9346240" "web" => "Medline" ] ] ] ] ] ] ] ] 54 => array:3 [ "identificador" => "bib0555" "etiqueta" => "55" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cellular survival: a play in three Akts" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "S.R. Datta" 1 => "A. Brunet" 2 => "M.E. Greenberg" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Genes Dev" "fecha" => "1999" "volumen" => "13" "paginaInicial" => "2905" "paginaFinal" => "2927" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10579998" "web" => "Medline" ] ] ] ] ] ] ] ] 55 => array:3 [ "identificador" => "bib0560" "etiqueta" => "56" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Involement of Bcl-2 family in apoptosis and signal pathways induced by cigarette smoke extract in the human airway smooth muscle cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "W. Hu" 1 => "J. Xie" 2 => "J. Zhao" 3 => "Y. Xu" 4 => "S. Yang" 5 => "W. Ni" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "DNA Cell Biol" "fecha" => "2009" "paginaInicial" => "13" "paginaFinal" => "22" ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:3 [ "titulo" => "Acknowledgments" "texto" => "<p id="par0140" class="elsevierStylePara elsevierViewall">The authors thank Mr. Rashid Ali (Institute of Nuclear Medicine and Allied Sciences, DRDO, New Delhi, India) for helping in handling animals. The authors thank the <span class="elsevierStyleGrantSponsor" id="gs1">Department of Science and Technology, Ministry of Science and Technology</span>, New Delhi, India for financial assistance and express their sincere gratitude to Swedish Orphan Biovitrum (SOBI), Stockholm, Sweden for providing rHuKGF.</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/15792129/0000005100000007/v1_201506250123/S1579212915000567/v1_201506250123/en/main.assets" "Apartado" => array:4 [ "identificador" => "9374" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original Articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/15792129/0000005100000007/v1_201506250123/S1579212915000567/v1_201506250123/en/main.pdf?idApp=UINPBA00003Z&text.app=https://archbronconeumol.org/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212915000567?idApp=UINPBA00003Z" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 November | 4 | 1 | 5 |
| 2024 October | 55 | 34 | 89 |
| 2024 September | 61 | 25 | 86 |
| 2024 August | 63 | 37 | 100 |
| 2024 July | 51 | 22 | 73 |
| 2024 June | 59 | 35 | 94 |
| 2024 May | 139 | 23 | 162 |
| 2024 April | 51 | 35 | 86 |
| 2024 March | 67 | 12 | 79 |
| 2024 February | 45 | 23 | 68 |
| 2023 March | 14 | 2 | 16 |
| 2023 February | 61 | 14 | 75 |
| 2023 January | 24 | 28 | 52 |
| 2022 December | 49 | 36 | 85 |
| 2022 November | 69 | 35 | 104 |
| 2022 October | 49 | 27 | 76 |
| 2022 September | 32 | 31 | 63 |
| 2022 August | 39 | 33 | 72 |
| 2022 July | 42 | 37 | 79 |
| 2022 June | 27 | 33 | 60 |
| 2022 May | 51 | 43 | 94 |
| 2022 April | 35 | 25 | 60 |
| 2022 March | 47 | 52 | 99 |
| 2022 February | 29 | 31 | 60 |
| 2022 January | 38 | 25 | 63 |
| 2021 December | 35 | 40 | 75 |
| 2021 November | 32 | 41 | 73 |
| 2021 October | 45 | 52 | 97 |
| 2021 September | 35 | 38 | 73 |
| 2021 August | 49 | 31 | 80 |
| 2021 July | 33 | 39 | 72 |
| 2021 June | 79 | 32 | 111 |
| 2021 May | 51 | 30 | 81 |
| 2021 April | 146 | 93 | 239 |
| 2021 March | 74 | 17 | 91 |
| 2021 February | 59 | 19 | 78 |
| 2021 January | 39 | 17 | 56 |
| 2020 December | 26 | 18 | 44 |
| 2020 November | 40 | 9 | 49 |
| 2020 October | 36 | 20 | 56 |
| 2020 September | 63 | 5 | 68 |
| 2020 August | 93 | 17 | 110 |
| 2020 July | 125 | 20 | 145 |
| 2020 June | 29 | 14 | 43 |
| 2020 May | 49 | 9 | 58 |
| 2020 April | 38 | 21 | 59 |
| 2020 March | 30 | 10 | 40 |
| 2020 February | 27 | 12 | 39 |
| 2020 January | 30 | 26 | 56 |
| 2019 December | 30 | 17 | 47 |
| 2019 November | 24 | 19 | 43 |
| 2019 October | 27 | 9 | 36 |
| 2019 September | 33 | 10 | 43 |
| 2019 August | 24 | 14 | 38 |
| 2019 July | 19 | 16 | 35 |
| 2019 June | 26 | 19 | 45 |
| 2019 May | 35 | 10 | 45 |
| 2019 April | 41 | 28 | 69 |
| 2019 March | 38 | 17 | 55 |
| 2019 February | 34 | 19 | 53 |
| 2019 January | 39 | 13 | 52 |
| 2018 December | 34 | 17 | 51 |
| 2018 November | 141 | 28 | 169 |
| 2018 October | 276 | 34 | 310 |
| 2018 September | 72 | 16 | 88 |
| 2018 May | 6 | 0 | 6 |
| 2018 April | 26 | 5 | 31 |
| 2018 March | 32 | 5 | 37 |
| 2018 February | 24 | 5 | 29 |
| 2018 January | 28 | 8 | 36 |
| 2017 December | 30 | 5 | 35 |
| 2017 November | 39 | 6 | 45 |
| 2017 October | 32 | 11 | 43 |
| 2017 September | 26 | 4 | 30 |
| 2017 August | 32 | 7 | 39 |
| 2017 July | 21 | 3 | 24 |
| 2017 June | 39 | 10 | 49 |
| 2017 May | 43 | 8 | 51 |
| 2017 April | 29 | 7 | 36 |
| 2017 March | 24 | 2 | 26 |
| 2017 February | 28 | 8 | 36 |
| 2017 January | 22 | 3 | 25 |
| 2016 December | 28 | 8 | 36 |
| 2016 November | 56 | 11 | 67 |
| 2016 October | 59 | 10 | 69 |
| 2016 September | 134 | 14 | 148 |
| 2016 August | 65 | 15 | 80 |
| 2016 July | 34 | 6 | 40 |
| 2016 March | 1 | 0 | 1 |
| 2016 February | 1 | 0 | 1 |
| 2016 January | 1 | 0 | 1 |
| 2015 December | 3 | 0 | 3 |
| 2015 November | 1 | 10 | 11 |
| 2015 October | 40 | 2 | 42 |
| 2015 September | 1 | 0 | 1 |
| 2015 August | 0 | 1 | 1 |
| 2015 July | 0 | 1 | 1 |
Show all
