Case report
Alpha-1-Antitrypsin Deficiency Associated With the Mattawa Variant
Déficit de alfa-1-antitripsina asociado a la variante Matawa
Beatriz Laraa,
, Beatriz Martínez-Delgadob, Maria Luisa Torresc, Sandra Marín-Arguedasd, Ana Bustamantee, Marc Miravitllesf
Corresponding author
a Servicio de Neumología, Hospital Universitario Arnau de Vilanova, Lleida, Spain
b Unidad de Genética Molecular, Área de Genética Humana, Instituto de Investigación en Enfermedades Raras, Instituto de Salud Carlos III, Madrid, Spain
c Servicio de Neumología, Complexo Hospitalario Universitario de Vigo, Vigo, Pontevedra, Spain
d Servicio de Neumología, Hospital Dos de Maig, Barcelona, Spain
e Servicio de Neumología, Hospital de Sierrallana, Torrelavega, Cantabria, Spain
f Servicio de Neumología, Hospital Universitario Vall d’Hebron, Barcelona, Spain
Read
7493
Timeswas read the article
2385
Total PDF
5108
Total HTML
Share statistics
array:24 [ "pii" => "S1579212913001924" "issn" => "15792129" "doi" => "10.1016/j.arbr.2013.10.010" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "784" "copyright" => "SEPAR" "copyrightAnyo" => "2013" "documento" => "simple-article" "crossmark" => 0 "subdocumento" => "crp" "cita" => "Arch Bronconeumol. 2013;49:548-50" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 4405 "formatos" => array:3 [ "EPUB" => 120 "HTML" => 3201 "PDF" => 1084 ] ] "Traduccion" => array:1 [ "es" => array:19 [ "pii" => "S030028961300152X" "issn" => "03002896" "doi" => "10.1016/j.arbres.2013.05.004" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "784" "copyright" => "SEPAR" "documento" => "article" "crossmark" => 0 "subdocumento" => "sco" "cita" => "Arch Bronconeumol. 2013;49:548-50" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 5983 "formatos" => array:3 [ "EPUB" => 100 "HTML" => 5217 "PDF" => 666 ] ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Nota clínica</span>" "titulo" => "Déficit de alfa-1-antitripsina asociado a la variante Matawa" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "548" "paginaFinal" => "550" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Alpha-1-Antitrypsin Deficiency Associated With the Mattawa Variant" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1103 "Ancho" => 2596 "Tamanyo" => 243756 ] ] "descripcion" => array:1 [ "es" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Secuencia correspondiente al exón 5 del gen SERPINA1. A)<span class="elsevierStyleHsp" style=""></span>Secuencia normal. B)<span class="elsevierStyleHsp" style=""></span>Secuencia correspondiente a la paciente, donde se ve la inserción de una timina (T) en vez de una adenina (A) en el codón 376 del exón 5 en heterocigosis, correspondiente al alelo PI-Mattawa. La secuencia codificante del gen SERPINA1 (exones 2 a 5) se analizó utilizando <span class="elsevierStyleItalic">primers</span> previamente descritos para los exones 3 a 5 y <span class="elsevierStyleItalic">primers</span> ex2F 5′ACGTGGTGTCAATCCCTGATCACTG3′ y ex2R 5′TATGGGAACAGCTGG3′ para el exón 2, tomando como referencia comparativa la SERPINA1_Transcript_ENST00000440909.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Beatriz Lara, Beatriz Martínez-Delgado, Maria Luisa Torres, Sandra Marín-Arguedas, Ana Bustamante, Marc Miravitlles" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Beatriz" "apellidos" => "Lara" ] 1 => array:2 [ "nombre" => "Beatriz" "apellidos" => "Martínez-Delgado" ] 2 => array:2 [ "nombre" => "Maria Luisa" "apellidos" => "Torres" ] 3 => array:2 [ "nombre" => "Sandra" "apellidos" => "Marín-Arguedas" ] 4 => array:2 [ "nombre" => "Ana" "apellidos" => "Bustamante" ] 5 => array:2 [ "nombre" => "Marc" "apellidos" => "Miravitlles" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S1579212913001924" "doi" => "10.1016/j.arbr.2013.10.010" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001924?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S030028961300152X?idApp=UINPBA00003Z" "url" => "/03002896/0000004900000012/v1_201312040037/S030028961300152X/v1_201312040037/es/main.assets" ] ] "itemSiguiente" => array:19 [ "pii" => "S1579212913001882" "issn" => "15792129" "doi" => "10.1016/j.arbr.2013.10.006" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "818" "copyright" => "SEPAR" "documento" => "article" "crossmark" => 0 "subdocumento" => "sco" "cita" => "Arch Bronconeumol. 2013;49:551-2" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 2945 "formatos" => array:3 [ "EPUB" => 118 "HTML" => 2162 "PDF" => 665 ] ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Clinical Image</span>" "titulo" => "Pulmonary Artery Aneurysm" "tienePdf" => "en" "tieneTextoCompleto" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "551" "paginaFinal" => "552" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Aneurisma de la arteria pulmonar" ] ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 716 "Ancho" => 3250 "Tamanyo" => 276617 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Chest X-ray, posterior–anterior (PA) (A) and lateral (B), in which a smooth rounded lesion at the level of the left hilum can be seen in the PA projection (arrows 1A), projecting into the retrosternal space (arrow 1B). Chest CT with the administration of intravenous contrast, sagittal and axial projection (C and D) confirms an aneurysmatic dilatation of the conus arteriosus.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Victoria Mayoral-Campos, José Luis de Benito-Arévalo, Marzo Antonio Varea-Sanz" "autores" => array:3 [ 0 => array:2 [ "nombre" => "Victoria" "apellidos" => "Mayoral-Campos" ] 1 => array:2 [ "nombre" => "José Luis" "apellidos" => "de Benito-Arévalo" ] 2 => array:2 [ "nombre" => "Marzo Antonio" "apellidos" => "Varea-Sanz" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S0300289613002378" "doi" => "10.1016/j.arbres.2013.07.016" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289613002378?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001882?idApp=UINPBA00003Z" "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001882/v1_201312010030/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1579212913001900" "issn" => "15792129" "doi" => "10.1016/j.arbr.2013.10.008" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "808" "copyright" => "SEPAR" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Arch Bronconeumol. 2013;49:534-47" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 9780 "formatos" => array:3 [ "EPUB" => 153 "HTML" => 7630 "PDF" => 1997 ] ] "en" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Recommendations of SEPAR</span>" "titulo" => "National Consensus on the Diagnosis, Risk Stratification and Treatment of Patients with Pulmonary Embolism" "tienePdf" => "en" "tieneTextoCompleto" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "534" "paginaFinal" => "547" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Consenso nacional sobre el diagnóstico, estratificación de riesgo y tratamiento de los pacientes con tromboembolia pulmonar" ] ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 4041 "Ancho" => 2253 "Tamanyo" => 312359 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Diagnostic algorithm for the hemodynamically stable outpatient. (A) Angio-CT, computed tomography angiography. <span class="elsevierStyleSup">1</span>Refers to high sensitivity D-dimer. In the case of less sensitive D-dimer, PE can only be ruled out in patients with low clinical probability or PE unlikely. <span class="elsevierStyleSup">2</span>In case of high clinical probability and negative multidetector angio-CT, additional diagnostic tests are suggested (V/Q scan and/or Doppler ultrasound of lower extremities). (B) DVT, deep vein thrombosis. <span class="elsevierStyleSup">1</span>Refers to low or intermediate probability V/Q scans. <span class="elsevierStyleSup">2</span>In case of high clinical probability, inconclusive perfusion scan, and negative ultrasound of lower extremities, the need for multidetector angio-CT should be assessed with the appropriate specialist.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Fernando Uresandi, Manuel Monreal, Ferrán García-Bragado, Pere Domenech, Ramón Lecumberri, Pilar Escribano, José Luis Zamorano, Sonia Jiménez, Pedro Ruiz-Artacho, Francisco Lozano, Antonio Romera, David Jiménez" "autores" => array:13 [ 0 => array:2 [ "nombre" => "Fernando" "apellidos" => "Uresandi" ] 1 => array:2 [ "nombre" => "Manuel" "apellidos" => "Monreal" ] 2 => array:2 [ "nombre" => "Ferrán" "apellidos" => "García-Bragado" ] 3 => array:2 [ "nombre" => "Pere" "apellidos" => "Domenech" ] 4 => array:2 [ "nombre" => "Ramón" "apellidos" => "Lecumberri" ] 5 => array:2 [ "nombre" => "Pilar" "apellidos" => "Escribano" ] 6 => array:2 [ "nombre" => "José Luis" "apellidos" => "Zamorano" ] 7 => array:2 [ "nombre" => "Sonia" "apellidos" => "Jiménez" ] 8 => array:2 [ "nombre" => "Pedro" "apellidos" => "Ruiz-Artacho" ] 9 => array:2 [ "nombre" => "Francisco" "apellidos" => "Lozano" ] 10 => array:2 [ "nombre" => "Antonio" "apellidos" => "Romera" ] 11 => array:2 [ "nombre" => "David" "apellidos" => "Jiménez" ] 12 => array:1 [ "colaborador" => "on behalf of the National Consensus on Diagnosis, Risk Stratification and Treatment of Patients With Pulmonary Thromboembolism" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S0300289613002263" "doi" => "10.1016/j.arbres.2013.07.008" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289613002263?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001900?idApp=UINPBA00003Z" "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001900/v1_201312010030/en/main.assets" ] "en" => array:21 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Case report</span>" "titulo" => "Alpha-1-Antitrypsin Deficiency Associated With the Mattawa Variant" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "548" "paginaFinal" => "550" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Beatriz Lara, Beatriz Martínez-Delgado, Maria Luisa Torres, Sandra Marín-Arguedas, Ana Bustamante, Marc Miravitlles" "autores" => array:6 [ 0 => array:4 [ "nombre" => "Beatriz" "apellidos" => "Lara" "email" => array:1 [ 0 => "beat1135@gmail.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">¿</span>" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "Beatriz" "apellidos" => "Martínez-Delgado" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "Maria Luisa" "apellidos" => "Torres" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 3 => array:3 [ "nombre" => "Sandra" "apellidos" => "Marín-Arguedas" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff0020" ] ] ] 4 => array:3 [ "nombre" => "Ana" "apellidos" => "Bustamante" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">e</span>" "identificador" => "aff0025" ] ] ] 5 => array:3 [ "nombre" => "Marc" "apellidos" => "Miravitlles" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">f</span>" "identificador" => "aff0030" ] ] ] ] "afiliaciones" => array:6 [ 0 => array:3 [ "entidad" => "Servicio de Neumología, Hospital Universitario Arnau de Vilanova, Lleida, Spain" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Unidad de Genética Molecular, Área de Genética Humana, Instituto de Investigación en Enfermedades Raras, Instituto de Salud Carlos III, Madrid, Spain" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Servicio de Neumología, Complexo Hospitalario Universitario de Vigo, Vigo, Pontevedra, Spain" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Servicio de Neumología, Hospital Dos de Maig, Barcelona, Spain" "etiqueta" => "d" "identificador" => "aff0020" ] 4 => array:3 [ "entidad" => "Servicio de Neumología, Hospital de Sierrallana, Torrelavega, Cantabria, Spain" "etiqueta" => "e" "identificador" => "aff0025" ] 5 => array:3 [ "entidad" => "Servicio de Neumología, Hospital Universitario Vall d’Hebron, Barcelona, Spain" "etiqueta" => "f" "identificador" => "aff0030" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Déficit de alfa-1-antitripsina asociado a la variante Matawa" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1104 "Ancho" => 2599 "Tamanyo" => 274980 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Sequence corresponding to exon 5 SERPINA1. (A) Normal sequence. (B) Sequence corresponding to the patient, which shows insertion of a thymine (T) instead of an adenine (A) at codon 376 in exon 5 of heterozygosity for the PI-Mattawa allele. The SERPINA1 gene coding sequence (exons 2–5) was analyzed using previously described primers for exons 3–5 and 5′ACGTGGTGTCAATCCCTGATCACTG3′ Ex2F primers and ex2R 5′TATGGGAACAGCTGG3′ for exon 2, with reference to the comparative SERPINA1_Transcript_ENST00000440909.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Normal alpha-1-antitrypsin (AAT) alleles, present in 85%–90% of individuals, are called M, and the most common deficient alleles, S and Z (frequencies: 10 and 1.7% of the Spanish population, respectively).<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> Patients homozygous for the M, S and Z alleles express around 100, 40 and 15% of serum AAT, respectively.<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">Severe AAT deficiency, defined as serum levels below 35% of the mean expected value, is a rare condition, generally associated with PI*ZZ homozygotes and much less frequently with combinations of Z, S, rare and null alleles. However, in recent years, the Spanish AAT Deficiency Registry (REDAAT) laboratory has detected rare and null alleles in 1.6% of cases<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">3</span></a> (a rate comparable with that found in Italy, Switzerland, Germany and the USA),<a class="elsevierStyleCrossRefs" href="#bib0020"><span class="elsevierStyleSup">4,5</span></a> mostly Mmalton, but also Mheerlen, Nullclayton, Nullbellingham, Mvhebron and Ybarcelona, among others.<a class="elsevierStyleCrossRefs" href="#bib0030"><span class="elsevierStyleSup">6–8</span></a></p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Case report</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Case 1</span><p id="par0015" class="elsevierStylePara elsevierViewall">The first patient was a 47-year-old woman, non-smoker, with essential hypertension, recurrent bronchitis since age 25, and exertional dyspnea in the last 3 years.</p><p id="par0020" class="elsevierStylePara elsevierViewall">Her spirometry was normal (FVC 96%, FEV<span class="elsevierStyleInf">1</span> 105%, FEV<span class="elsevierStyleInf">1</span>/FVC 84), but her carbon monoxide diffusing capacity (DLCO) and transfer coefficient (KCO) were 68 and 61% of their respective theoretical values. Chest computed tomography (CT) showed an accentuated bronchial pattern with no signs of bronchiectasis or emphysema. Liver function tests were normal. The serum AAT concentration was 73.7<span class="elsevierStyleHsp" style=""></span>mg/dL (reference values: 103–200), consistent with partial AAT deficiency, but the phenotype labeled as PI*MM did not agree with the AAT concentrations. It was therefore decided to perform gene sequencing of the AAT in peripheral blood, in which a PI*Nullmattawa allele was detected. This mutation is characterized by the insertion of a nucleotide within the coding region of exon 5, and results in a frameshift that creates a premature stop signal at position 376 (p.Leu353PhefsX24). This finally translates into a very unstable truncated protein that is degraded inside the hepatocyte and is undetectable in serum<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a> (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>).</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0025" class="elsevierStylePara elsevierViewall">The second allele of the patient contained a normal variant in exon 5, consisting of a substitution of a cytosine (C) for an adenine (A) in nucleotide 1200 of the cDNA, generating the replacement of a glutamic acid (Glu) by an aspartate (Asp) in codon 400 (c. 1200A>C/p.Glu400Asp), which corresponded to an M3 allele. Therefore, this is a PI*M3Nullmattawa heterozygous genotype, with moderately reduced serum AAT levels.</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Case 2</span><p id="par0030" class="elsevierStylePara elsevierViewall">Another carrier of the Nullmattawa allele was identified from the REDAAT database.<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a></p><p id="par0035" class="elsevierStylePara elsevierViewall">The patient was a 67-year-old woman with a history of pleuro-pulmonary tuberculosis, with documented bacteriological cure. She suffered frequent respiratory infections. Functional parameters were consistent with severe airway obstruction (FEV<span class="elsevierStyleInf">1</span>: 620<span class="elsevierStyleHsp" style=""></span>ml and FVC: 1280<span class="elsevierStyleHsp" style=""></span>ml, 22% and 39% of the theoretical values, respectively). High resolution computed tomography (CT) showed diffuse centrilobular and paraseptal emphysema and diffuse cylindrical bronchiectasis. No result indicating liver involvement was detected at any time.</p><p id="par0040" class="elsevierStylePara elsevierViewall">Her serum AAT concentrations were 43<span class="elsevierStyleHsp" style=""></span>mg/dL. IEF suggested a PI*MM phenotype, but as it did not correspond with the serum AAT concentrations, a genetic study was performed. This detected a PI*Mmalton allele (deletion of residue 52, p.Phe52del)<a class="elsevierStyleCrossRef" href="#bib0055"><span class="elsevierStyleSup">11</span></a> and a PI*Nullmattawa allele, the combination of which explained the patient's low serum AAT concentrations.</p></span></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Discussion</span><p id="par0045" class="elsevierStylePara elsevierViewall">The exceptional nature of the null alleles (estimated prevalence 100–200 times lower than the Z alleles) precludes us from having precise knowledge of their clinical impact and real incidence. Nevertheless, it is important to take them into account, as they can create diagnostic confusion if genomic studies are not performed.</p><p id="par0050" class="elsevierStylePara elsevierViewall">The Mmalton allele (also known as Mcagliari and Mnichinan) was first described in 1987 and, like the Z gene, produces a poorly folded protein. Around 80%–90% of this variant polymerizes in the hepatocyte without being secreted into the blood, where it expresses levels less than 15% when in homozygosity. It is associated with a high risk of pulmonary emphysema and liver disease.<a class="elsevierStyleCrossRefs" href="#bib0055"><span class="elsevierStyleSup">11,12</span></a></p><p id="par0055" class="elsevierStylePara elsevierViewall">The Mattawa allele (and in general any null allele) codes for a truncated protein, with major conformational changes, which is degraded intracellularly without having the opportunity to aggregate, and hence expresses undetectable serum AAT concentrations. This means that homozygotes have a very high risk of emphysema, but not of liver disease.</p><p id="par0060" class="elsevierStylePara elsevierViewall">In conclusion, in our patients, the discrepancy between the IEF phenotype and the serum AAT concentrations led us to suspect the existence of rare alleles. Molecular analysis of the gene finally provided the correct diagnosis, as stated in the recommendations.<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a></p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conflict of Interest</span><p id="par0065" class="elsevierStylePara elsevierViewall">The authors declare no conflict of interest.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:9 [ 0 => array:2 [ "identificador" => "xres296096" "titulo" => "Abstract" ] 1 => array:2 [ "identificador" => "xpalclavsec279771" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "xres296097" "titulo" => "Resumen" ] 3 => array:2 [ "identificador" => "xpalclavsec279770" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Case report" "secciones" => array:2 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Case 1" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Case 2" ] ] ] 6 => array:2 [ "identificador" => "sec0025" "titulo" => "Discussion" ] 7 => array:2 [ "identificador" => "sec0030" "titulo" => "Conflict of Interest" ] 8 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2013-04-04" "fechaAceptado" => "2013-05-09" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec279771" "palabras" => array:3 [ 0 => "Alpha-1-antitrypsin deficiency" 1 => "Mattawa" 2 => "Spanish Registry of patients with alpha-1-antitrypsin deficiency" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec279770" "palabras" => array:3 [ 0 => "Déficit de alfa-1-antitripsina" 1 => "Mattawa" 2 => "Registro Español de pacientes con déficit de alfa-1-antitripsina" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">The most common deficiency alleles for alpha-1-antitrypsin deficiency (AATD) are Pi*S and Pi*S, but there are also other deficiency variants.</p><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">This case report describes the first two cases of AATD detected in Spain resulting from the combination of a null Mattawa allele with a normal PI*M, and a rare Mmalton.</p><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Both cases were initially diagnosed as Pi*MM by isoelectric focusing (IEF), but the low serum AAT values led us to suspect the existence of rare deficiency alleles that were undetectable using this technique, and to performing molecular analysis of the gene, which provided the correct diagnosis.</p><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Inconsistencies between serum AAT values and the phenotype should make one suspect the existence of one of these rare alleles.</p>" ] "es" => array:2 [ "titulo" => "Resumen" "resumen" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Los alelos deficitarios más frecuentes son los Pi*S y Pi*Z, pero existen también otras variantes deficientes.</p><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">En la presente nota clínica se describen los 2 primeros casos detectados en España de déficit de alfa-1-antitripsina (DAAT), resultante de la combinación de un alelo nulo Mattawa con un normal PI*M y con un raro Mmalton.</p><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Ambos casos fueron inicialmente diagnosticados como Pi*MM por isoelectroenfoque (IEE), pero los valores séricos bajos de AAT hicieron sospechar la existencia de alelos deficientes infrecuentes indetectables por IEE, por lo que se realizó un análisis molecular del gen que proporcionó el diagnóstico correcto.</p><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Las incoherencias entre los valores séricos de AAT y el fenotipo deben hacer sospechar la existencia de uno de estos alelos infrecuentes.</p>" ] ] "NotaPie" => array:1 [ 0 => array:2 [ "etiqueta" => "☆" "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Please cite this article as: Lara B, Martínez-Delgado B, Torres ML, Marín-Arguedas S, Bustamante A, Miravitlles M. Déficit de alfa-1-antitripsina asociado a la variante Matawa. Arch Bronconeumol. 2013;49:548–550.</p>" ] ] "multimedia" => array:1 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1104 "Ancho" => 2599 "Tamanyo" => 274980 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Sequence corresponding to exon 5 SERPINA1. (A) Normal sequence. (B) Sequence corresponding to the patient, which shows insertion of a thymine (T) instead of an adenine (A) at codon 376 in exon 5 of heterozygosity for the PI-Mattawa allele. The SERPINA1 gene coding sequence (exons 2–5) was analyzed using previously described primers for exons 3–5 and 5′ACGTGGTGTCAATCCCTGATCACTG3′ Ex2F primers and ex2R 5′TATGGGAACAGCTGG3′ for exon 2, with reference to the comparative SERPINA1_Transcript_ENST00000440909.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:12 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "P.I.*S and PI*Z alpha-1 antitrypsin deficiency: estimated prevalence and number of deficient subjects in Spain" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "I. Blanco" 1 => "E. Fernández-Bustillo" 2 => "F.J. de Serres" 3 => "D. Alkassam" 4 => "C. Rodríguez" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Med Clin (Barc)" "fecha" => "2004" "volumen" => "123" "paginaInicial" => "761" "paginaFinal" => "765" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Normativa sobre diagnóstico y tratamiento del déficit de alfa-1 antitripsina" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "R. Vidal" 1 => "I. Blanco" 2 => "F. Casas" 3 => "R. Jardí" 4 => "M. Miravitlles" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Arch Bronconeumol" "fecha" => "2006" "volumen" => "42" "paginaInicial" => "645" "paginaFinal" => "659" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17178069" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Rare alpha-1 antitrypsin variants: are they really so rare?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "F. Rodríguez-Frías" 1 => "M. Miravitlles" 2 => "R. Vidal" 3 => "S. Campos" 4 => "R. Jardi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1177/1753465811434320" "Revista" => array:6 [ "tituloSerie" => "Ther Adv Respir Dis" "fecha" => "2012" "volumen" => "6" "paginaInicial" => "79" "paginaFinal" => "85" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22291048" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "SERPINA1 gen variants in individuals from general population with reduced alpha-1-antitrypsin concentrations" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Zorzetto" 1 => "E. Russi" 2 => "O. Senn" 3 => "M. Imboden" 4 => "I. Ferrarotti" 5 => "C. Tinelli" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1373/clinchem.2007.102798" "Revista" => array:6 [ "tituloSerie" => "Clin Chem" "fecha" => "2008" "volumen" => "54" "paginaInicial" => "1331" "paginaFinal" => "1338" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18515255" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Alpha 1-antitrypsin phenotypes and associated serum protein concentrations in a large clinical population" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J.A. Bornhorst" 1 => "D.N. Greene" 2 => "E.R. Ashwood" 3 => "D.G. Grenache" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1378/chest.12-0564" "Revista" => array:6 [ "tituloSerie" => "Chest" "fecha" => "2013" "volumen" => "143" "paginaInicial" => "1000" "paginaFinal" => "1008" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23632999" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Characterization of the new alpha-1-antitrypsin-deficient PI M-type allele, PI M(vall d’hebron) (Pro(369)-->Ser)" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R. Jardí" 1 => "F. Rodríguez-Frías" 2 => "J.C. López-Talavera" 3 => "M. Miravitlles" 4 => "M. Cotrina" 5 => "X. Costa" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "22935" "Revista" => array:6 [ "tituloSerie" => "Hum Hered" "fecha" => "2000" "volumen" => "50" "paginaInicial" => "320" "paginaFinal" => "321" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10878477" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Emphysema due to alpha-antitrypsin deficiency: familial study of the YBARCELONA variant" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M. Miravitlles" 1 => "S. Vilà" 2 => "R. Jardí" 3 => "C. de la Roza" 4 => "F. Rodríguez-Frías" 5 => "R. Vidal" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Chest" "fecha" => "2003" "volumen" => "124" "paginaInicial" => "404" "paginaFinal" => "406" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12853554" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0302283812002278" "estado" => "S300" "issn" => "03022838" ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Alpha-1-antitrypsin deficiency caused by the alpha-1-antitrypsin null(Mattawa) gene: an insertion mutation rendering the alpha-1-antitrypsin gene incapable of producing alpha-1-antitrypsin" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "D. Curiel" 1 => "M. Brantly" 2 => "E. Curiel" 3 => "L. Stier" 4 => "R.G. Crystal" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI113994" "Revista" => array:6 [ "tituloSerie" => "J Clin Invest" "fecha" => "1989" "volumen" => "83" "paginaInicial" => "1144" "paginaFinal" => "1152" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2539391" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Emphysema of early onset associated with a complete deficiency of alpha-1-antitrypsin (null homozygotes)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "D.W. Cox" 1 => "H. Levison" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1164/ajrccm/137.2.371" "Revista" => array:6 [ "tituloSerie" => "Am Rev Respir Dis" "fecha" => "1988" "volumen" => "137" "paginaInicial" => "371" "paginaFinal" => "375" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/3257661" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Development and results of the Spanish Registry of patients with alpha-1-antitrypsin deficiency" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "B. Lara" 1 => "C. de la Roza" 2 => "S. Vilà" 3 => "R. Vidal" 4 => "M. Miravitlles" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Int J COPD" "fecha" => "2007" "volumen" => "2" "paginaInicial" => "1" "paginaFinal" => "6" "itemHostRev" => array:3 [ "pii" => "S0302283810001338" "estado" => "S300" "issn" => "03022838" ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "In-frame single codon deletion in the M(Malton) deficiency allele of alpha-1-antitrypsin" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "G.C. Fraizer" 1 => "T.R. Harrold" 2 => "M.H. Hofker" 3 => "D.W. Cox" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Am J Hum Genet" "fecha" => "1989" "volumen" => "44" "paginaInicial" => "894" "paginaFinal" => "902" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2786335" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular characterisation of three alpha-1-antitrypsin deficiency variants: proteinase inhibitor (Pi) Null (Cardiff) (asp256-to-val), Pi M(Malton) (phe51-deletion) and Pi I (arg39-to-cys)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A. Graham" 1 => "N.A. Kalsheker" 2 => "C.R. Newton" 3 => "F.J. Bamforth" 4 => "S.J. Powell" 5 => "A.F. Markham" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Hum Genet" "fecha" => "1989" "volumen" => "84" "paginaInicial" => "55" "paginaFinal" => "58" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2606478" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:3 [ "titulo" => "Acknowledgements" "texto" => "<p id="par0070" class="elsevierStylePara elsevierViewall">The authors thank Dr. Ignacio Blanco for his important contribution to the writing of this article.</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001924/v1_201312010030/en/main.assets" "Apartado" => array:4 [ "identificador" => "9347" "tipo" => "SECCION" "es" => array:2 [ "titulo" => "Case reports" "idiomaDefecto" => true ] "idiomaDefecto" => "es" ] "PDF" => "https://static.elsevier.es/multimedia/15792129/0000004900000012/v1_201312010030/S1579212913001924/v1_201312010030/en/main.pdf?idApp=UINPBA00003Z&text.app=https://archbronconeumol.org/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001924?idApp=UINPBA00003Z" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 November | 2 | 2 | 4 |
| 2024 October | 40 | 20 | 60 |
| 2024 September | 46 | 18 | 64 |
| 2024 August | 70 | 36 | 106 |
| 2024 July | 45 | 21 | 66 |
| 2024 June | 67 | 30 | 97 |
| 2024 May | 77 | 38 | 115 |
| 2024 April | 36 | 28 | 64 |
| 2024 March | 47 | 25 | 72 |
| 2024 February | 36 | 20 | 56 |
| 2023 March | 16 | 2 | 18 |
| 2023 February | 43 | 23 | 66 |
| 2023 January | 33 | 35 | 68 |
| 2022 December | 45 | 43 | 88 |
| 2022 November | 55 | 21 | 76 |
| 2022 October | 48 | 35 | 83 |
| 2022 September | 43 | 29 | 72 |
| 2022 August | 44 | 34 | 78 |
| 2022 July | 50 | 46 | 96 |
| 2022 June | 70 | 34 | 104 |
| 2022 May | 81 | 27 | 108 |
| 2022 April | 32 | 39 | 71 |
| 2022 March | 38 | 46 | 84 |
| 2022 February | 47 | 37 | 84 |
| 2022 January | 40 | 35 | 75 |
| 2021 December | 31 | 47 | 78 |
| 2021 November | 43 | 40 | 83 |
| 2021 October | 51 | 39 | 90 |
| 2021 September | 46 | 43 | 89 |
| 2021 August | 34 | 31 | 65 |
| 2021 July | 45 | 32 | 77 |
| 2021 June | 27 | 27 | 54 |
| 2021 May | 33 | 35 | 68 |
| 2021 April | 42 | 73 | 115 |
| 2021 March | 40 | 17 | 57 |
| 2021 February | 35 | 22 | 57 |
| 2021 January | 33 | 17 | 50 |
| 2020 December | 43 | 15 | 58 |
| 2020 November | 26 | 13 | 39 |
| 2020 October | 28 | 14 | 42 |
| 2020 September | 25 | 19 | 44 |
| 2020 August | 24 | 11 | 35 |
| 2020 July | 28 | 21 | 49 |
| 2020 June | 21 | 9 | 30 |
| 2020 May | 23 | 16 | 39 |
| 2020 April | 41 | 22 | 63 |
| 2020 March | 26 | 10 | 36 |
| 2020 February | 27 | 13 | 40 |
| 2020 January | 31 | 16 | 47 |
| 2019 December | 37 | 20 | 57 |
| 2019 November | 28 | 21 | 49 |
| 2019 October | 57 | 14 | 71 |
| 2019 September | 44 | 21 | 65 |
| 2019 August | 39 | 15 | 54 |
| 2019 July | 41 | 19 | 60 |
| 2019 June | 33 | 19 | 52 |
| 2019 May | 45 | 16 | 61 |
| 2019 April | 52 | 36 | 88 |
| 2019 March | 50 | 30 | 80 |
| 2019 February | 30 | 18 | 48 |
| 2019 January | 29 | 18 | 47 |
| 2018 December | 40 | 15 | 55 |
| 2018 November | 83 | 26 | 109 |
| 2018 October | 78 | 25 | 103 |
| 2018 September | 27 | 10 | 37 |
| 2018 July | 1 | 0 | 1 |
| 2018 May | 19 | 0 | 19 |
| 2018 April | 321 | 6 | 327 |
| 2018 March | 31 | 8 | 39 |
| 2018 February | 35 | 12 | 47 |
| 2018 January | 30 | 9 | 39 |
| 2017 December | 51 | 11 | 62 |
| 2017 November | 44 | 13 | 57 |
| 2017 October | 45 | 14 | 59 |
| 2017 September | 45 | 8 | 53 |
| 2017 August | 54 | 23 | 77 |
| 2017 July | 39 | 12 | 51 |
| 2017 June | 57 | 20 | 77 |
| 2017 May | 74 | 17 | 91 |
| 2017 April | 62 | 9 | 71 |
| 2017 March | 45 | 26 | 71 |
| 2017 February | 47 | 15 | 62 |
| 2017 January | 25 | 9 | 34 |
| 2016 December | 63 | 8 | 71 |
| 2016 November | 75 | 26 | 101 |
| 2016 October | 63 | 23 | 86 |
| 2016 September | 76 | 14 | 90 |
| 2016 August | 68 | 16 | 84 |
| 2016 July | 51 | 14 | 65 |
| 2016 March | 6 | 0 | 6 |
| 2016 February | 1 | 0 | 1 |
| 2015 December | 2 | 0 | 2 |
| 2015 October | 64 | 4 | 68 |
| 2015 September | 47 | 28 | 75 |
| 2015 August | 54 | 29 | 83 |
| 2015 July | 55 | 12 | 67 |
| 2015 June | 34 | 25 | 59 |
| 2015 May | 47 | 39 | 86 |
| 2015 April | 42 | 36 | 78 |
| 2015 March | 47 | 39 | 86 |
| 2015 February | 44 | 15 | 59 |
| 2015 January | 54 | 17 | 71 |
| 2014 December | 39 | 12 | 51 |
| 2014 November | 33 | 17 | 50 |
| 2014 October | 50 | 17 | 67 |
| 2014 September | 51 | 20 | 71 |
| 2014 August | 69 | 15 | 84 |
| 2014 July | 38 | 10 | 48 |
| 2014 June | 61 | 17 | 78 |
| 2014 May | 56 | 22 | 78 |
| 2014 April | 55 | 23 | 78 |
| 2014 March | 68 | 22 | 90 |
| 2014 February | 1 | 0 | 1 |
| 2014 January | 1 | 2 | 3 |
| 2013 December | 1 | 2 | 3 |
Show all
