National Consensus on the Diagnosis, Risk Stratification and Treatment of Patients with Pulmonary Embolism

array:24 ["pii" => "S1579212913001900" "issn" => "15792129" "doi" => "10.1016/j.arbr.2013.10.008" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "808" "copyright" => "SEPAR" "copyrightAnyo" => "2013" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Arch Bronconeumol. 2013;49:534-47" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 9780 "formatos" => array:3 [ "EPUB" => 153 "HTML" => 7630 "PDF" => 1997 ] ] "Traduccion" => array:1 [ "es" => array:19 [ "pii" => "S0300289613002263" "issn" => "03002896" "doi" => "10.1016/j.arbres.2013.07.008" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "808" "copyright" => "SEPAR" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Arch Bronconeumol. 2013;49:534-47" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 138621 "formatos" => array:3 [ "EPUB" => 171 "HTML" => 123289 "PDF" => 15161 ] ] "es" => array:11 [ "idiomaDefecto" => true "cabecera" => "Normativa SEPAR" "titulo" => "Consenso nacional sobre el diagnóstico, estratificación de riesgo y tratamiento de los pacientes con tromboembolia pulmonar" "tienePdf" => "es" "tieneTextoCompleto" => "es" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "534" "paginaFinal" => "547" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "National Consensus on the Diagnosis, Risk Stratification and Treatment of Patients with Pulmonary Embolism" ] ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figura 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2263 "Ancho" => 3137 "Tamanyo" => 361981 ] ] "descripcion" => array:1 [ "es" => "Estratificación pronóstica y tratamiento de la tromboembolia pulmonar en fase aguda. BNP: péptido natriurético cerebral; DVD: disfunción ventricular derecha; Fx: fondaparinux; HBPM: heparina de bajo peso molecular; HFABP: proteína ligadora de ácidos grasos cardiacos; HNF: heparina no fraccionada; hsTnT: troponina T de alta sensibilidad; PESI: Pulmonary Embolism Severity Index; PESIs: PESI simplificada; TVP: trombosis venosa profunda; UCI: unidad de cuidados intensivos.*Shock cardiogénico o presión arterial sistólica<90mm Hg mantenida, no debida a hipovolemia, sepsis o arritmias cardiacas. La línea discontinua indica ausencia de evidencia definitiva (fibrinólisis) o de experiencia clínica amplia (rivaroxaban). Para aquellas situaciones no contempladas en el algoritmo, se recomienda hospitalización y tratamiento anticoagulante convencional." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Fernando Uresandi, Manuel Monreal, Ferrán García-Bragado, Pere Domenech, Ramón Lecumberri, Pilar Escribano, José Luis Zamorano, Sonia Jiménez, Pedro Ruiz-Artacho, Francisco Lozano, Antonio Romera, David Jiménez" "autores" => array:13 [ 0 => array:2 [ "nombre" => "Fernando" "apellidos" => "Uresandi" ] 1 => array:2 [ "nombre" => "Manuel" "apellidos" => "Monreal" ] 2 => array:2 [ "nombre" => "Ferrán" "apellidos" => "García-Bragado" ] 3 => array:2 [ "nombre" => "Pere" "apellidos" => "Domenech" ] 4 => array:2 [ "nombre" => "Ramón" "apellidos" => "Lecumberri" ] 5 => array:2 [ "nombre" => "Pilar" "apellidos" => "Escribano" ] 6 => array:2 [ "nombre" => "José Luis" "apellidos" => "Zamorano" ] 7 => array:2 [ "nombre" => "Sonia" "apellidos" => "Jiménez" ] 8 => array:2 [ "nombre" => "Pedro" "apellidos" => "Ruiz-Artacho" ] 9 => array:2 [ "nombre" => "Francisco" "apellidos" => "Lozano" ] 10 => array:2 [ "nombre" => "Antonio" "apellidos" => "Romera" ] 11 => array:2 [ "nombre" => "David" "apellidos" => "Jiménez" ] 12 => array:1 [ "colaborador" => "en representación del Consenso nacional sobre el diagnóstico, estratificación de riesgo y tratamiento de los pacientes con tromboembolia pulmonar" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S1579212913001900" "doi" => "10.1016/j.arbr.2013.10.008" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001900?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289613002263?idApp=UINPBA00003Z" "url" => "/03002896/0000004900000012/v1_201312040037/S0300289613002263/v1_201312040037/es/main.assets" ] ] "itemSiguiente" => array:19 [ "pii" => "S1579212913001924" "issn" => "15792129" "doi" => "10.1016/j.arbr.2013.10.010" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "784" "copyright" => "SEPAR" "documento" => "simple-article" "crossmark" => 0 "subdocumento" => "crp" "cita" => "Arch Bronconeumol. 2013;49:548-50" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 4405 "formatos" => array:3 [ "EPUB" => 120 "HTML" => 3201 "PDF" => 1084 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "Case report" "titulo" => "Alpha-1-Antitrypsin Deficiency Associated With the Mattawa Variant" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "548" "paginaFinal" => "550" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Déficit de alfa-1-antitripsina asociado a la variante Matawa" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1104 "Ancho" => 2599 "Tamanyo" => 274980 ] ] "descripcion" => array:1 [ "en" => "Sequence corresponding to exon 5 SERPINA1. (A) Normal sequence. (B) Sequence corresponding to the patient, which shows insertion of a thymine (T) instead of an adenine (A) at codon 376 in exon 5 of heterozygosity for the PI-Mattawa allele. The SERPINA1 gene coding sequence (exons 2–5) was analyzed using previously described primers for exons 3–5 and 5′ACGTGGTGTCAATCCCTGATCACTG3′ Ex2F primers and ex2R 5′TATGGGAACAGCTGG3′ for exon 2, with reference to the comparative SERPINA1_Transcript_ENST00000440909." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Beatriz Lara, Beatriz Martínez-Delgado, Maria Luisa Torres, Sandra Marín-Arguedas, Ana Bustamante, Marc Miravitlles" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Beatriz" "apellidos" => "Lara" ] 1 => array:2 [ "nombre" => "Beatriz" "apellidos" => "Martínez-Delgado" ] 2 => array:2 [ "nombre" => "Maria Luisa" "apellidos" => "Torres" ] 3 => array:2 [ "nombre" => "Sandra" "apellidos" => "Marín-Arguedas" ] 4 => array:2 [ "nombre" => "Ana" "apellidos" => "Bustamante" ] 5 => array:2 [ "nombre" => "Marc" "apellidos" => "Miravitlles" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S030028961300152X" "doi" => "10.1016/j.arbres.2013.05.004" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S030028961300152X?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001924?idApp=UINPBA00003Z" "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001924/v1_201312010030/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1579212913001742" "issn" => "15792129" "doi" => "10.1016/j.arbr.2013.09.011" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "751" "copyright" => "SEPAR" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Arch Bronconeumol. 2013;49:529-33" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 5857 "formatos" => array:3 [ "EPUB" => 134 "HTML" => 4259 "PDF" => 1464 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Special Article" "titulo" => "Comprehensive Care of Amyotrophic Lateral Sclerosis Patients: A Care Model" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "529" "paginaFinal" => "533" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Atención integral a pacientes con esclerosis lateral amiotrófica: un modelo asistencial" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Maria Rosa Güell, Antonio Antón, Ricardo Rojas-García, Carmen Puy, Jesus Pradas" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Maria Rosa" "apellidos" => "Güell" ] 1 => array:2 [ "nombre" => "Antonio" "apellidos" => "Antón" ] 2 => array:2 [ "nombre" => "Ricardo" "apellidos" => "Rojas-García" ] 3 => array:2 [ "nombre" => "Carmen" "apellidos" => "Puy" ] 4 => array:2 [ "nombre" => "Jesus" "apellidos" => "Pradas" ] 5 => array:1 [ "colaborador" => "on behalf of the entire interdisciplinary team" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S0300289613000562" "doi" => "10.1016/j.arbres.2013.01.013" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289613000562?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001742?idApp=UINPBA00003Z" "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001742/v1_201312010030/en/main.assets" ] "en" => array:18 [ "idiomaDefecto" => true "cabecera" => "Recommendations of SEPAR" "titulo" => "National Consensus on the Diagnosis, Risk Stratification and Treatment of Patients with Pulmonary Embolism" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "534" "paginaFinal" => "547" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Fernando Uresandi, Manuel Monreal, Ferrán García-Bragado, Pere Domenech, Ramón Lecumberri, Pilar Escribano, José Luis Zamorano, Sonia Jiménez, Pedro Ruiz-Artacho, Francisco Lozano, Antonio Romera, David Jiménez" "autores" => array:13 [ 0 => array:3 [ "nombre" => "Fernando" "apellidos" => "Uresandi" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "Manuel" "apellidos" => "Monreal" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "Ferrán" "apellidos" => "García-Bragado" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 3 => array:3 [ "nombre" => "Pere" "apellidos" => "Domenech" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "d" "identificador" => "aff0020" ] ] ] 4 => array:3 [ "nombre" => "Ramón" "apellidos" => "Lecumberri" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "e" "identificador" => "aff0025" ] ] ] 5 => array:3 [ "nombre" => "Pilar" "apellidos" => "Escribano" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "f" "identificador" => "aff0030" ] ] ] 6 => array:3 [ "nombre" => "José Luis" "apellidos" => "Zamorano" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "g" "identificador" => "aff0035" ] ] ] 7 => array:3 [ "nombre" => "Sonia" "apellidos" => "Jiménez" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "h" "identificador" => "aff0040" ] ] ] 8 => array:3 [ "nombre" => "Pedro" "apellidos" => "Ruiz-Artacho" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "i" "identificador" => "aff0045" ] ] ] 9 => array:3 [ "nombre" => "Francisco" "apellidos" => "Lozano" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "j" "identificador" => "aff0050" ] ] ] 10 => array:3 [ "nombre" => "Antonio" "apellidos" => "Romera" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "k" "identificador" => "aff0055" ] ] ] 11 => array:4 [ "nombre" => "David" "apellidos" => "Jiménez" "email" => array:1 [ 0 => "djc_69_98@yahoo.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "l" "identificador" => "aff0060" ] 1 => array:2 [ "etiqueta" => "¿" "identificador" => "cor0005" ] ] ] 12 => array:2 [ "colaborador" => "on behalf of the National Consensus on Diagnosis, Risk Stratification and Treatment of Patients With Pulmonary Thromboembolism" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "1" "identificador" => "fn1" ] 1 => array:2 [ "etiqueta" => "2" "identificador" => "fn2" ] ] ] ] "afiliaciones" => array:12 [ 0 => array:3 [ "entidad" => "Servicio de Neumología, Hospital de Cruces, Bilbao, Spain" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Servicio de Medicina Interna, Hospital Germans Trias I Pujol, Badalona, Spain" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Servicio de Medicina Interna, Hospital Universitario de Gerona Dr. Josep Trueta, Gerona, Spain" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Servicio de Hematología, Hospital Universitario de Bellvitge, Barcelona, Spain" "etiqueta" => "d" "identificador" => "aff0020" ] 4 => array:3 [ "entidad" => "Servicio de Hematología, Clínica Universitaria de Navarra, Pamplona, Spain" "etiqueta" => "e" "identificador" => "aff0025" ] 5 => array:3 [ "entidad" => "Servicio de Cardiología, Hospital Doce de Octubre, Madrid, Spain" "etiqueta" => "f" "identificador" => "aff0030" ] 6 => array:3 [ "entidad" => "Servicio de Cardiología, Hospital Ramón y Cajal, IRYCIS, Madrid, Spain" "etiqueta" => "g" "identificador" => "aff0035" ] 7 => array:3 [ "entidad" => "Servicio de Urgencias, Hospital Clinic, Barcelona, Spain" "etiqueta" => "h" "identificador" => "aff0040" ] 8 => array:3 [ "entidad" => "Servicio de Urgencias, Hospital Clínico San Carlos, Madrid, Spain" "etiqueta" => "i" "identificador" => "aff0045" ] 9 => array:3 [ "entidad" => "Servicio de Angiología y Cirugía Vascular, Hospital Universitario de Bellvitge, Barcelona, Spain" "etiqueta" => "j" "identificador" => "aff0050" ] 10 => array:3 [ "entidad" => "Servicio de Angiología y Cirugía Vascular, Hospital Clínico Universitario, Salamanca, Spain" "etiqueta" => "k" "identificador" => "aff0055" ] 11 => array:3 [ "entidad" => "Servicio de Neumología, Hospital Ramón y Cajal, IRYCIS, Madrid, Spain" "etiqueta" => "l" "identificador" => "aff0060" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Consenso nacional sobre el diagnóstico, estratificación de riesgo y tratamiento de los pacientes con tromboembolia pulmonar" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 4041 "Ancho" => 2253 "Tamanyo" => 312359 ] ] "descripcion" => array:1 [ "en" => "Diagnostic algorithm for the hemodynamically stable outpatient. (A) Angio-CT, computed tomography angiography. 1Refers to high sensitivity D-dimer. In the case of less sensitive D-dimer, PE can only be ruled out in patients with low clinical probability or PE unlikely. 2In case of high clinical probability and negative multidetector angio-CT, additional diagnostic tests are suggested (V/Q scan and/or Doppler ultrasound of lower extremities). (B) DVT, deep vein thrombosis. 1Refers to low or intermediate probability V/Q scans. 2In case of high clinical probability, inconclusive perfusion scan, and negative ultrasound of lower extremities, the need for multidetector angio-CT should be assessed with the appropriate specialist." ] ] ] "textoCompleto" => "IntroductionPulmonary embolism (PE) is a public health problem of the first order. Although less common than other vascular diseases, such as myocardial infarction or cerebrovascular disease, PE is equally as serious. The Spanish Medical Societies involved in the care of these patients have drawn up a consensus document that aims to update the recommendations for the diagnosis, prognosis and treatment of this disease using the best available evidence. This consensus document makes recommendations or suggestions based on the interpretation of the available evidence and its quality, risk-benefit balance of the interventions, and the cost. This was based on two documents: Antithrombotic Therapy and Prevention of Thrombosis, 9th ed.: American College of Chest Physicians (ACCP). Evidence-Based Clinical Practice Guidelines<a class="elsevierStyleCrossRef" href="#bib0005">1</a> and the National Institute for Health and Clinical Excellence (NICE) clinical guidelines on venous thromboembolic (VTE) diseases.<a class="elsevierStyleCrossRef" href="#bib0010">2</a> Both documents use the GRADE system<a class="elsevierStyleCrossRef" href="#bib0015">3</a> to establish recommendations. A systematic review of the literature published between January 2012 and March 2013 was also performed. Based on these documents and the systematic literature review, two authors (FU and DJ) prepared a manuscript that formed the basis for the final discussion (in a face-to-face meeting) by a panel composed of the coordinators of each of the participating Scientific Societies. All the recommendations or suggestions were agreed between the attendees at this session. Consensus was reached by discussion between the panel members, considering the potential risks and benefits of the interventions, routine clinical practice, recommendations of other guidelines, patient preference, and equity criteria. The authors of the document also took into account clinical situations in which a lack of evidence justifies waiting until research results become available in the future.Concept, Pathogenesis, Risk Factors and EpidemiologyPE occurs when a detached thrombus (embolism) from any part of the venous territory becomes lodged in the pulmonary arteries. Although the origin of the embolism may be venous thrombosis in any location (upper extremities, prostatic, uterine and renal veins and right heart chambers), in most cases (90%–95%) it is a lower extremity (LE) deep vein thrombosis (DVT), often asymptomatic.The risk factors (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>) for developing PE are related with one or several of the etiopathogenic mechanisms of the disease: stasis, endothelial lesion and hypercoagulability. These guidelines classify them as major or minor, depending on whether their prothrombotic risk is high or moderate-low, respectively. When the VTE is associated with precipitating risk factors, it is classified as provoked or secondary. When there are no precipitating factors, it is known as unprovoked, spontaneous or idiopathic.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>There is an estimated incidence of PE of 1 case per 1000 population per year, although the real incidence is likely to be higher. According to data from the Spanish Ministry for Health, 22 250 cases of PE were diagnosed in 2010, with an in-hospital mortality of 8.9%.DiagnosisNo single test is sensitive and specific enough to confirm or rule out acute symptomatic PE. The diagnosis of the disease must therefore be combined with clinical suspicion, D-dimer results and imaging tests. Following widely accepted diagnostic algorithms improves the prognosis in patients assessed for suspected PE.<a class="elsevierStyleCrossRef" href="#bib0020">4</a> A diagnostic algorithm has been proposed for hemodynamically stable patients with suspected PE (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>A and B) and another for unstable patients (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>).<elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia>The diagnostic process does not justify delays in initiating anticoagulant treatment, which should be administered early in patients with intermediate or high clinical suspicion.<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005">•It is recommended to start anticoagulant treatment early (before the results of diagnostic tests become available) in patients with an intermediate or high probability of PE.</li></ul>Clinical SuspicionThe diagnosis of acute symptomatic PE should be considered in all patients who report new onset dyspnea, worsening of their usual dyspnea, chest pain, syncope or hypotension with no alternative explanation, particularly when the basic complementary tests (chest X-ray, electrocardiogram and arterial blood gases) rule out other differential diagnoses. <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a> lists some of the usual radiological and electrocardiographic findings in PE. Standardized testing using clinical prediction rules classifies patients into categories with different PE prevalence (approximately 10% for low probability, 25% for intermediate probability and >60% for high probability) and facilitates the interpretation of other diagnostic tests. The Wells and Geneva scores (<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>) have been the most extensively validated.<ul class="elsevierStyleList" id="lis0010"><li class="elsevierStyleListItem" id="lsti0010">•The use of adequately validated clinical scales (Wells or Geneva) is recommended as a first step in the diagnostic approach to the hemodynamically stable patient with suspected PE.</li></ul><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><elsevierMultimedia ident="tbl0015"></elsevierMultimedia>D-DimerD-dimer is a fibrin degradation product present in the thrombus, generated when the clot undergoes proteolysis by plasmin. It is a highly sensitive test, but has low specificity, because the finding of high levels may also be associated with other clinical situations such as advanced age, infection, cancer, pregnancy or hospital admission.In normotensive patients with a low or intermediate probability of PE, a negative high sensitivity (≥95%) D-dimer (<500ng/ml) excludes the diagnosis of PE. In patients who do not receive anticoagulant therapy, the incidence of VTE in the following 3 months is 0.14% (95% confidence interval [CI], 0.05–0.41).<a class="elsevierStyleCrossRef" href="#bib0025">5</a> Low or moderate sensitivity methods for determination of D-dimer (<95%) (<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>) only exclude the disease in the group of patients with low clinical probability (or with PE unlikely according to the dichotomized Wells score).<ul class="elsevierStyleList" id="lis0015"><li class="elsevierStyleListItem" id="lsti0015">•It is recommended that the sensitivity of the D-dimer method used in each setting is known.</li><li class="elsevierStyleListItem" id="lsti0020">•A negative high sensitivity D-dimer excludes PE in patients with low or intermediate clinical probability.</li><li class="elsevierStyleListItem" id="lsti0025">•A negative moderate or low sensitivity D-dimer excludes PE in patients with low clinical probability (or PE unlikely).</li><li class="elsevierStyleListItem" id="lsti0030">•It is recommended not to measure D-dimer in patients with a high probability of PE.</li></ul><elsevierMultimedia ident="tbl0020"></elsevierMultimedia>Imaging TestsThe most commonly used imaging tests are multidetector chest computed tomography angiography (angio-CT), ventilation/perfusion (V/Q) lung scan and venous ultrasound of the LE, with or without Doppler (DU).Multidetector Computed Tomography AngiographyMultidetector angio-CT is currently the imaging test of choice for the diagnosis of PE. In a systematic review and meta-analysis<a class="elsevierStyleCrossRef" href="#bib0030">6</a> that included 2020 patients from 3 studies, the thromboembolic risk in patients who did not receive anticoagulant treatment based on a negative angio-CT was 1.2% (95% CI, 0.8–1.8), with a risk of fatal PE of 0.6%.PIOPED II<a class="elsevierStyleCrossRef" href="#bib0035">7</a> was a multicenter study that evaluated the diagnostic usefulness of 4, 8 or 16 detector angio-CT in patients with suspected PE. The overall sensitivity was 83% (95% CI, 76–92) and the specificity was 96% (95% CI, 93–97). In this study, the negative predictive value (NPV) of multidetector angio-CT increased marginally when venography was added in the same examination. It should be noted that the NPV of multidetector angio-CT was only 60% in patients with a high clinical probability of PE.Multidetector angio-CT provides an effective dose of radiation of 7milliSievert, equivalent to 2 years of natural background radiation, which translates into a low additional lifetime risk of fatal cancer.<a class="elsevierStyleCrossRef" href="#bib0040">8</a> Existing equipment enables the test to be performed with a reduced radiation dose. Nevertheless, the indication in fertile women must be justified in terms of the risk-benefit balance. In pregnant women, it is advisable to perform a perfusion scan before multidetector angio-CT, due to the lower radiation, provided that the chest X-ray is normal.<a class="elsevierStyleCrossRef" href="#bib0045">9</a> If multidetector angio-CT is done, breast protection is recommended. It is not known if it has any effect on breast milk during breastfeeding. In patients with renal failure, angio-CT may be performed following local protocols for prevention of contrast-induced nephropathy.<ul class="elsevierStyleList" id="lis0020"><li class="elsevierStyleListItem" id="lsti0035">•A negative multidetector angio-CT (technically adequate) rules out PE, except in patients with a high clinical probability of the disease.</li><li class="elsevierStyleListItem" id="lsti0040">•It is recommended that additional diagnostic tests be carried out in patients with suspected PE and inconclusive multidetector angio-CT.</li><li class="elsevierStyleListItem" id="lsti0045">•It is suggested that additional diagnostic tests be carried out in patients with a high suspicion of PE and negative multidetector angio-CT.</li><li class="elsevierStyleListItem" id="lsti0050">•It is recommended not to perform CT venography routinely to increase the diagnostic yield of multidetector angio-CT.</li></ul>Lung ScintigraphyThe V/Q scan has been replaced by multidetector angio-CT as the diagnostic test of choice. At present, it is generally reserved for patients with iodinated contrast allergy, some cases with renal failure or for pregnant women with suspected PE in which the DU of the LE was negative, providing that the chest x-ray was normal.In the PIOPED I study,<a class="elsevierStyleCrossRef" href="#bib0050">10</a> the NPV of a normal scan was 97% and the positive predictive value (PPV) of a high-probability scan was 85%–90%. However, the scan was diagnostic (normal or high probability) in only 30%–50% of patients. In the remaining patients, the V/Q scan was inconclusive (low, intermediate or indeterminate probability).<ul class="elsevierStyleList" id="lis0025"><li class="elsevierStyleListItem" id="lsti0055">•A normal V/Q scan rules out clinically significant PE.</li><li class="elsevierStyleListItem" id="lsti0060">•A high-probability V/Q scan confirms PE in patients with an intermediate or high probability of the disease.</li><li class="elsevierStyleListItem" id="lsti0065">•It is recommended that additional diagnostic tests be carried out in patients with suspected PE and inconclusive V/Q scan.</li></ul>Lower Extremity Venous UltrasoundDU is the method of choice for the detection of concomitant DVT in patients with PE. The main diagnostic criterion is lack of compressibility of the venous lumen. It is particularly sensitive and specific in patients with DVT symptoms and in the femoropopliteal territory, but its yield decreases when the DVT is asymptomatic or located in the sural territory. Approximately 50% of patients with acute symptomatic PE have concomitant DVT at the time of diagnosis, only half of whom are symptomatic. It is presently reserved for use in patients with discrepancy between the clinical probability and the result of the thoracic imaging tests, for patients with inconclusive thoracic tests, and for pregnant patients as a first examination in the diagnostic algorithm.<ul class="elsevierStyleList" id="lis0030"><li class="elsevierStyleListItem" id="lsti0070">•DU is recommended as a first examination in pregnant patients with suspected PE.</li></ul>Pulmonary Magnetic Resonance AngiographyA priori, this test does not differ from multidetector angio-CT in obtaining images of the pulmonary arterial tree. It has the advantage that it uses gadolinium (which does not contain iodine) as a contrast and does not radiate patients. In the PIOPED III study, its sensitivity was 78% and specificity was 99%.<a class="elsevierStyleCrossRef" href="#bib0055">11</a> On extending the study with magnetic resonance venography, the sensitivity increased to 92% with a specificity of 96%. The examination was technically inadequate in 25% of patients, which is its major limitation. It may be reserved for patients with iodinated contrast allergy. In the case of severe renal failure (creatinine clearance <30ml/min), it is contraindicated due to the toxicity of gadolinium. It should be avoided in pregnancy and breastfeeding, although there is no clear evidence of teratogenic effects.<ul class="elsevierStyleList" id="lis0035"><li class="elsevierStyleListItem" id="lsti0075">•It is recommended not to perform pulmonary magnetic resonance angiography routinely for the diagnosis of patients with suspected PE.</li></ul>Transthoracic EchocardiographyIn general, transthoracic echocardiography is not useful in the diagnostic algorithm of patients with suspected PE. Although multidetector angio-CT is also the diagnostic test of choice in hemodynamically unstable patients with suspected PE, bedside echocardiography may provide very valuable diagnostic information in centers in which multidetector angio-CT is not available, or in cases in which the patient's instability prevents their transfer to the radiology department. In critically ill patients, the absence of echocardiography signs of right-sided heart dysfunction or overload rules out PE as a cause of hemodynamic compromise.<ul class="elsevierStyleList" id="lis0040"><li class="elsevierStyleListItem" id="lsti0080">•It is recommended not to perform transthoracic echocardiography routinely for the diagnosis of stable patients with suspected PE.</li></ul>Prognostic Stratification of Patients With Pulmonary EmbolismPE is a disease with a wide spectrum of clinical manifestations, with different prognoses and treatment. The most important prognostic factor is the patient's hemodynamic status at the time of diagnosis.<a class="elsevierStyleCrossRef" href="#bib0060">12</a>High-risk PE (previously known as massive PE), which is characterized by hypotension or shock, accounts for around 5% of cases and is associated with early mortality in at least 15%. Thrombolytic treatment is usually recommended for these patients.However, most patients with PE present with few symptoms. Early mortality in hemodynamically stable patients diagnosed with PE varies between 2% and 10%. Risk stratification of normotensive patients with PE should be used to identify a subgroup of patients with a low risk of all-cause mortality, who may benefit from early discharge or even outpatient treatment of their disease, and a subgroup of patients with a higher risk of complications associated with the PE itself (intermediate-risk PE, previously sub-massive PE), who may benefit from aggressive treatments for their disease (intensive monitoring, fibrinolysis).<a class="elsevierStyleCrossRef" href="#bib0065">13</a>Prognostic FactorsThe most commonly used prognostic factors in normotensive patients with PE are summarized in <a class="elsevierStyleCrossRef" href="#tbl0025">Table 5</a>. In general, these tools assess the patient's clinical condition and general health status, right ventricular dysfunction, the thrombotic burden and myocardial damage.<elsevierMultimedia ident="tbl0025"></elsevierMultimedia>Identification of Patients With Low-Risk Pulmonary EmbolismThe most useful tools for classifying low risk patients with acute symptomatic PE are the prognostic clinical scores. The combination of a set of variables that takes into account the age, comorbidity and cardiovascular repercussion of PE reliably identifies a subgroup of patients (approximately 30%) with a less than 2% risk of early mortality. The Pulmonary Embolism Severity Index (PESI) and simplified PESI (sPESI) clinical scores (<a class="elsevierStyleCrossRef" href="#tbl0030">Table 6</a>) have been extensively validated as excellent tools for the identification of these low risk patients.<a class="elsevierStyleCrossRefs" href="#bib0070">14,15</a> The sPESI score is easier to use than the original, while retaining its prognostic ability.<elsevierMultimedia ident="tbl0030"></elsevierMultimedia>The value of combining the clinical scores and some biochemical markers (particularly brain natriuretic peptide [BNP] or high sensitivity troponin [hsTnT]) or imaging tests (transthoracic echocardiogram or DU) for the identification of this group of low risk patients has not been completely clarified.<ul class="elsevierStyleList" id="lis0045"><li class="elsevierStyleListItem" id="lsti0085">•It is recommended to use well validated prognostic clinical scores (PESI or simplified PESI) as a first step for the identification of patients with low-risk PE.</li></ul>Identification of Patients With Intermediate-Risk Pulmonary EmbolismThe most widely used method in clinical practice for evaluating right ventricular function is transthoracic echocardiography. Various quantitative parameters (right ventricular end-diastolic diameter in the parasternal long axis view, ventricular end-diastolic diameter ratio in the apical 4C projection, tricuspid regurgitation peak velocity, diameter of the inferior vena cava, pulmonary artery acceleration time or TAPSE [Tricuspid Annular Plane Systolic Excursion]) have been used to estimate the degree of ventricular dysfunction. Its use for the identification of patients with intermediate-risk PE is limited by its operator-dependence, cost and lack of continuous availability in many centers. Furthermore, there is no echocardiographic pattern of right ventricular dysfunction that is sufficiently reliable as to justify, on its own, the use of fibrinolytic treatment.<a class="elsevierStyleCrossRef" href="#bib0080">16</a>The images generated by angio-CT not only enable the diagnosis of PE to be confirmed or discarded, but they can also assess the extension of the arterial obstruction and the presence or not of right ventricular dilatation.<a class="elsevierStyleCrossRefs" href="#bib0085">17,18</a> Although ventricular size volumetric reconstruction studies may offer a more accurate prognostic assessment, more recent studies use the ratio between the ventricular diameters as a parameter of ventricular dysfunction (with different cut-off points). Its isolated use for identifying patients with intermediate-risk PE who could benefit from fibrinolytic treatment is not recommended.Various meta-analyses have demonstrated the prognostic value of myocardial ischemia (identified by elevated troponin I or T levels) in hemodynamically stable patients with PE, although the power of the association is not sufficiently robust as to justify therapeutic escalation.<a class="elsevierStyleCrossRefs" href="#bib0095">19,20</a> Cardiomyocyte stress causes release of natriuretic peptides into the circulation (BNP and NT-pro-BNP).<a class="elsevierStyleCrossRefs" href="#bib0105">21,22</a> Several studies and meta-analyses suggest that they are useful for identifying patients with intermediate-risk PE. However, the sensitivity of these cardiac biomarkers for death due to PE is insufficient to establish the indication for thrombolytic treatment.An association has been shown between the persistence of thrombotic material in the lower extremity deep vein system and short- and mid-term mortality of patients with PE.<a class="elsevierStyleCrossRef" href="#bib0115">23</a> The presence of concomitant DVT, together with other imaging tests and cardiac biomarkers, may serve to identify a patient profile with a particularly high risk of complications associated with the PE itself.<ul class="elsevierStyleList" id="lis0050"><li class="elsevierStyleListItem" id="lsti0090">•A combination of prognostic tests (which identify right ventricular dysfunction, myocardial ischemia, cardiomyocyte stress or thrombotic burden) is suggested for identifying patients with intermediate risk PE.</li></ul>Treatment of Pulmonary Embolism in the Initial Phase (Acute Phase And up to 3–6 Months)The initial treatment of PE is aimed at medical stabilization of the patient and symptom relief, resolution of the vascular obstruction and prevention of recurrence. The priority in achieving these objectives depends on the severity of the patient. On most occasions, all the objectives are reached with conventional anticoagulant treatment, which prevents progression of the clot while the endogenous fibrinolytic system resolves the vascular obstruction and collateral circulation develops. A minority of patients, usually those with hemodynamic instability (high-risk PE) or contraindication for anticoagulation, require other pharmacological treatments (thrombolytics) or mechanical measures (vena caval filters) to accelerate lysis of the clot or prevent its embolization to the lungs<a class="elsevierStyleCrossRef" href="#bib0005">1</a> (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>). <a class="elsevierStyleCrossRef" href="#tbl0035">Table 7</a> lists the administration guidelines for drugs approved for treatment of the acute phase of PE.<elsevierMultimedia ident="fig0015"></elsevierMultimedia><elsevierMultimedia ident="tbl0035"></elsevierMultimedia>Anticoagulation With Unfractionated Heparin, Low Molecular Weight Heparins or FondaparinuxFor decades, unfractionated heparin (UFH) has been the drug of choice for the treatment of PE. It exerts its anticoagulant action by binding to antithrombin and potentiating its effect in the inactivation of a series of activated coagulation factors, mainly thrombin (IIa). It is usually administered intravenously (iv) as a continuous infusion, but it is also safe and effective using the subcutaneous route (sc). It requires monitoring using the activated partial thromboplastin time (APTT), which should be 1.5–2.5 times the control value, so an initial infusion rate of 18U/kg/h is used. As well as continuous infusion, an 80U/kg bolus is usually administered to achieve a more rapid anticoagulant effect. Patients who are treated with lower doses and who do not reach a therapeutic APTT in the first few days of treatment have an increased risk of recurrent VTE. It is not known if there is a relationship between sub-therapeutic APTT levels and recurrence in patients who are treated initially with the recommended doses. UFH is currently reserved for patients in whom the use of fibrinolytic treatment is considered (intermediate- or high-risk PE), and for patients at a high risk of bleeding who are to receive anticoagulant therapy. For patients with severe renal failure (creatinine clearance <30ml/min), some indirect evidence suggests that low molecular weight heparins (LMWH) (at the doses recommended in the Summary of Product Characteristics) could be safer and more effective than UFH.<a class="elsevierStyleCrossRef" href="#bib0120">24</a>LMWH are prepared from the fractionation of UFH by chemical or enzymatic methods. They have potent antiXa action (greater than that of UFH). Most studies suggest that LMWH and UFH are equivalent in terms of efficacy (recurrent VTE) and safety (major bleeding) for treatment of the acute phase of VTE. In a meta-analysis that included 1951 patients from 12 studies comparing LMWH with UFH, LMWH were associated with fewer recurrent VTE (odds ratio [OR] 0.63; 95% CI, 0.33–1.18) and fewer major bleeding events (OR 0.67; 95% CI, 0.36–1.27), with no differences in mortality (OR 1.20; 95% CI, 0.59–2.45).<a class="elsevierStyleCrossRef" href="#bib0125">25</a>Fondaparinux is a synthetic pentasaccharide that selectively inhibits factor Xa without inactivating thrombin. It is administered subcutaneously once daily at weight-adjusted doses and does not require monitoring. The Matisse investigators evaluated its efficacy and safety in the treatment of acute DVT and PE.<a class="elsevierStyleCrossRef" href="#bib0130">26</a> Compared with UFH, they did not observe any differences in the rate of recurrent thromboembolic events (1.3% vs 1.7% in the acute phase), major bleeds (1.3% vs 1.1%) or mortality in the first 3 months of follow-up. A potential advantage of this drug is that it is not associated with heparin-induced thrombocytopenia (HIT).<ul class="elsevierStyleList" id="lis0055"><li class="elsevierStyleListItem" id="lsti0095">•The use of LMWH or fondaparinux instead of UFH is suggested in hemodynamically stable patients with acute PE.</li><li class="elsevierStyleListItem" id="lsti0100">•The use of LMWH at doses adjusted to the UFH is suggested in patients with acute PE and severe renal failure.</li></ul>Beginning Oral AnticoagulationStudies demonstrating that heparin treatment for 5 days instead of 10 is a safe, effective practice also showed that oral anticoagulants could be started on the first day of anticoagulation, without losing efficacy. Two clinical trials with warfarin have shown that: (1) loading doses (which may cause hemorrhages) should be avoided without this incurring a delay in reaching therapeutic INR levels; (2) commencing vitamin K antagonists (VKA) at lower doses avoids excessive falls in protein C levels, which would theoretically induce a state of hypercoagulability.<ul class="elsevierStyleList" id="lis0060"><li class="elsevierStyleListItem" id="lsti0105">•In hemodynamically stable patients with PE, it is recommended that parenteral anticoagulation be maintained for at least 5 days, and until the INR is >2.0 for 24h.</li></ul>New Oral AnticoagulantsNew oral anticoagulants have recently been introduced that act differently to the VKA, among which are dabigatran (direct thrombin inhibitor), rivaroxaban and apixaban (factor Xa inhibitors). Rivaroxaban is a direct selective factor Xa inhibitor. In the joint analysis of two clinical trials (for DVT and PE), rivaroxaban was associated with an efficacy similar to that of standard treatment (hazard ratio [HR] 0.87; 95% CI, 0.66–1.19) while major bleeding was reduced to half (HR 0.54, 95% CI, 0.37–0.79).<a class="elsevierStyleCrossRefs" href="#bib0135">27,28</a> Its oral administration, at a dose of 15mg twice daily for 3 weeks followed by 20mg once daily, could provide a simple, single-drug approach to the acute and long-term treatment of PE.Apixaban has been evaluated in a clinical trial for the treatment of patients with DVT or PE (34%) for the first 6 months after a thrombotic event.<a class="elsevierStyleCrossRef" href="#bib0145">29</a> Compared with standard treatment, apixaban showed similar efficacy (relative risk [RR] 0.84; 95% CI, 0.60–1.18) and a statistically significant reduction in major bleeding (RR 0.31; IC 95%, 0.17–0.55) and clinically relevant non-major bleeding (RR 0.48; 95% CI, 0.38–0.60). It was administered orally, at a dose of 10mg twice daily for the first 7 days followed by 5mg twice daily.The efficacy and safety of dabigatran has not been evaluated during the first 10 days (on average) of treatment of acute symptomatic PE.<ul class="elsevierStyleList" id="lis0065"><li class="elsevierStyleListItem" id="lsti0110">•Treatment with rivaroxaban as monotherapy is suggested in hemodynamically stable patients with PE.</li></ul>Early vs Standard Discharge in Pulmonary Embolism PatientsThe results of a clinical trial and some cohort studies suggest that, compared with hospitalization, outpatient treatment in low risk patients is equally effective and safe in terms of recurrent VTE, bleeding events and mortality.<a class="elsevierStyleCrossRef" href="#bib0150">30</a> Outpatient treatment can be considered in patients with PE who meet the following requirements: (1) clinically stable with good cardiopulmonary reserve, and a low risk validated clinical score (e.g. PESI or sPESI), (2) good social support with rapid access to medical care and (3) expected treatment compliance.<ul class="elsevierStyleList" id="lis0070"><li class="elsevierStyleListItem" id="lsti0115">•In patients with low-risk PE and adequate home conditions, early discharge is suggested instead of standard discharge (more than 5 days admission).</li></ul>Early Mobilization vs Rest in Acute Pulmonary EmbolismSeveral meta-analyses have shown that early mobilization is a safe practice in patients with proximal DVT.<a class="elsevierStyleCrossRef" href="#bib0155">31</a> The evidence is less consistent for patients with symptomatic PE. The presence of concomitant DVT worsens the prognosis in patients with PE, particularly when associated with right ventricular dysfunction and myocardial ischemia.<a class="elsevierStyleCrossRef" href="#bib0160">32</a><ul class="elsevierStyleList" id="lis0075"><li class="elsevierStyleListItem" id="lsti0120">•Early mobilization is suggested in patients with low-risk PE.</li><li class="elsevierStyleListItem" id="lsti0125">•Rest is suggested for the first few days of treatment in patients with intermediate-risk PE.</li></ul>Fibrinolytic TreatmentThrombolytic treatment accelerates clot lysis and hemodynamic improvement occurs more rapidly than with UFH treatment, although there are no differences in the residual thrombosis after 5–7 days. Analysis of a subgroup of patients in the Urokinase Pulmonary Embolism Trial (UPET), which compared urokinase followed by UFH or UFH alone, showed that fibrinolytic treatment reduces mortality in patients with shock secondary to massive PE.<a class="elsevierStyleCrossRef" href="#bib0165">33</a> Based on these findings, and in the absence of a high risk of bleeding, thrombolytic treatment is indicated in patients with acute symptomatic PE and hemodynamic instability (defined as cardiogenic shock or sustained systolic blood pressure <90mmHg, not due to hypovolemia, sepsis or cardiac arrhythmias).<a class="elsevierStyleCrossRef" href="#bib0170">34</a> Hemodynamic instability is rare, but up to half of patients with PE without hemodynamic instability have clinical and echocardiographic signs of right ventricular dysfunction (intermediate-risk PE). Although not routinely recommended,<a class="elsevierStyleCrossRef" href="#bib0175">35</a> and pending publication of the results of the Pulmonary Embolism Thrombolysis Study (PEITHO),<a class="elsevierStyleCrossRef" href="#bib0180">36</a> the decision to use thrombolytic treatment in a very selected group of patients will depend on their risk of bleeding and the severity of the clinical symptoms.Thrombolytic treatment administered for 2h is safer and more effective than 12–24-h regimens. Streptokinase and recombinant tissue plasminogen activator (rt-PA) are equally effective with this short administration regimen. It should be administered via a peripheral route. Administration through a central line is not more effective and increases the risk of bleeding at the venous access insertion site.<ul class="elsevierStyleList" id="lis0080"><li class="elsevierStyleListItem" id="lsti0130">•The administration of systemic fibrinolytic treatment is recommended in patients with PE and cardiogenic shock.</li><li class="elsevierStyleListItem" id="lsti0135">•The administration of systemic fibrinolytic treatment is suggested in patients with PE and hypotension without a high risk of bleeding.</li><li class="elsevierStyleListItem" id="lsti0140">•It is recommended not to administer fibrinolytic treatment in most hemodynamically stable patients with PE.</li><li class="elsevierStyleListItem" id="lsti0145">•In hemodynamically stable patients with intermediate-risk PE and a low risk of bleeding, particularly in the under 75s, it is suggested that the administration of fibrinolytic treatment be assessed.</li></ul>Vena Caval FiltersVena caval filters are indicated in PE patients with a contraindication for anticoagulation therapy. Decousus et al. published a clinical trial evaluating the usefulness of vena caval filters, as a complement to conventional anticoagulation, in patients with DVT and high-risk PE.<a class="elsevierStyleCrossRef" href="#bib0185">37</a> The filters reduced the frequency of PE during the first 12 days of treatment, and a tendency toward a lower number of fatal episodes was detected. After 2 years, there were no differences between the two groups in terms of mortality or recurrent VTE, due to an increase in the frequency of DVT in the group treated with filters. These findings indirectly support the use of vena caval filters in patients in whom anticoagulation is contraindicated in the acute phase. A recoverable filter should be inserted when possible, and should be removed as soon as anticoagulation can be commenced.<ul class="elsevierStyleList" id="lis0085"><li class="elsevierStyleListItem" id="lsti0150">•Placement of an inferior vena caval filter is recommended in hemodynamically stable patients with PE and a contraindication for anticoagulation.</li></ul>Other TreatmentsIn experienced centers, mechanical thrombus fragmentation is performed in patients with high-risk PE and a contraindication for the use of fibrinolytics. Pulmonary embolectomy is another method of treatment for high-risk PE. It is indicated in cases of right-sided heart thrombi, high risk of paradoxical arterial embolism or in patients with high-risk PE in whom fibrinolysis has not been effective.<a class="elsevierStyleCrossRef" href="#bib0190">38</a> The results improve if patients undergo the procedure before developing cardiogenic shock.<ul class="elsevierStyleList" id="lis0090"><li class="elsevierStyleListItem" id="lsti0155">•In patients with high-risk PE and who (i) have a contraindication for fibrinolysis, (ii) fibrinolysis has failed, or (iii) the shock is likely to cause death of the patient before the fibrinolysis is effective, the use of interventionist catheterization techniques or pulmonary embolectomy is suggested if the necessary resources and expertise are available.</li></ul>Support TreatmentPatients with acute symptomatic PE should receive supplementary oxygen to obtain saturations higher than 92%. Oxygen therapy, especially in patients with right-sided heart overload, acts as a vasodilator and may contribute to the decrease in pressure in the pulmonary arteries.Pleuritic chest pain is a common symptom in patients with PE. It can be relieved on most occasions by administering non-steroidal anti-inflammatory agents within 24–48h. The administration of these drugs does not increase the risk of bleeding in acute PE.The administration of fluids (<500ml) may be beneficial for increasing the cardiac output in patients with PE, low output and sustained systemic pressures. Dopamine or dobutamine can be used in patients with low output and sustained systemic pressures. For hypotensive patients with PE, adrenaline combines the beneficial effects of noradrenaline and dobutamine.Treatment of Isolated Subsegmental Pulmonary EmbolismA meta-analysis of studies that performed chest angio-CT for suspected PE found that the incidence of subsegmental PE was 4.7% (95% CI, 2.5–7.6) and 9.4% (95% CI, 5.5–14.2) in patients undergoing single- and multidetector CT. respectively.<a class="elsevierStyleCrossRef" href="#bib0195">39</a> There were no differences between the two groups in the incidence of thrombotic events during the first 3 months of follow-up when the patients did not receive anticoagulant therapy based on a negative angio-CT.Treatment of Incidental Pulmonary EmbolismIncidental PE (unsuspected) is detected in approximately 2% of patients (most with cancer) in whom a chest CT is performed for reasons other than suspected PE. Some indirect evidence suggests that incidental PE worsens the prognosis in these patients.<a class="elsevierStyleCrossRef" href="#bib0200">40</a> The recommendation for indicating anticoagulant therapy is more consistent when the incidental PE is associated with concomitant PE, the PE is lobar or in the main arteries and the risk of bleeding is not high.<ul class="elsevierStyleList" id="lis0095"><li class="elsevierStyleListItem" id="lsti0160">•Anticoagulant therapy is suggested in patients with incidental PE in a segmental, lobar or main location.</li></ul>Treatment of Right-Sided Heart ThrombiThe presence of right-sided heart thrombi, particularly when they are mobile, significantly worsens the prognosis in patients with PE. Some indirect evidence suggests that fibrinolysis or surgical embolectomy is more effective than conventional anticoagulant therapy in these patients.Long-term Treatment of Pulmonary Thromboembolism (After the First 3–6 Months)Duration of TreatmentThe appropriate duration of anticoagulant treatment requires a balance between the risk of recurrent VTE and the risk of bleeding complications.Risk of RecurrenceThe risk of recurrent VTE depends on (1) the efficacy of treatment of the acute episode, (2) a minimum duration of long-term treatment, (3) the possibility of the patient having an intrinsic risk factor for suffering a new VTE episode.In a meta-analysis that included 2925 patients who had suffered a first episode of VTE not secondary to cancer, and who had received treatment of different durations, the risk of recurrence increased significantly for treatment durations less than 3 months (HR 1.52; 95% CI, 1.14–2.02).<a class="elsevierStyleCrossRef" href="#bib0205">41</a> There were no differences in the risk of recurrence for treatment durations of 3 months compared to durations of 6 or more months (HR 1.19; 95% CI, 0.86–1.85). Based on this evidence, it is agreed that long-term treatment of patients with PE should have a minimum duration of 3 months.In the aforementioned meta-analysis,<a class="elsevierStyleCrossRef" href="#bib0205">41</a> the risk of recurrence was significantly lower for events caused by a temporary risk factor than for unprovoked events (HR 0.55; 95% CI, 0.41–0.74). In a systematic review<a class="elsevierStyleCrossRef" href="#bib0210">42</a> that included 15 clinical trials, the risk of recurrent VTE during follow-up for patients with unprovoked VTE was 2.3–2.5 times higher than that of patients with provoked VTE, 7.9–10.6 times higher than patients with VTE provoked by a surgical risk factor, and 1.4–1.8 times higher than that of patients with VTE provoked by a non-surgical risk factor.Although the literature is not consistent, for the purpose of decision-making on treatment duration, these guidelines stratify PE as provoked by a major risk factor, provoked by a minor risk factor, unprovoked or secondary to cancer (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>).<elsevierMultimedia ident="fig0020"></elsevierMultimedia>Bleeding RiskThere are no bleeding risk scales that have been sufficiently validated in patients on anticoagulant therapy for an episode of VTE. The RIETE registry<a class="elsevierStyleCrossRef" href="#bib0215">43</a> derived a score for predicting the risk of bleeding in the first 3 months of anticoagulant therapy from 19274 patients diagnosed with DVT or PE (<a class="elsevierStyleCrossRef" href="#tbl0040">Table 8</a>). Based on the weight of each of the variables on the scale, patients were classified into three risk groups: low, intermediate and high. The incidence of major bleeding in the internal validation cohort was 0.1%, 2.8% and 6.2%, respectively.<elsevierMultimedia ident="tbl0040"></elsevierMultimedia>After the third month of anticoagulant therapy, the evidence is more limited. The 9th edition of the ACCP<a class="elsevierStyleCrossRef" href="#bib0005">1</a> proposes a scale for risk of bleeding from a series of variables that have been associated with bleeding events in the literature (<a class="elsevierStyleCrossRef" href="#tbl0045">Table 9</a>). According to this model, the risk of a major bleed is low (0.3%) in the absence of any risk factor, moderate (0.6%) in the presence of one risk factor, and high (≥2.5%) if there are two or more risk factors. This model has not been validated in an external cohort of patients with VTE.<elsevierMultimedia ident="tbl0045"></elsevierMultimedia>Decision StrategiesTwo decision strategies have been developed on the duration of long-term anticoagulation in patients with PE: a population strategy and an individualized strategy. The first of these only considers provoked PE, unprovoked PE or PE secondary to cancer for making set recommendations on the duration of anticoagulant treatment. The second takes into account the clinical characteristics of each patient (age, sex, comorbidity, presentation of the event) and some other additional factor (D-dimer) to suggest individualized plans for duration of anticoagulant treatment. The authors of these guidelines suggest a mixed approach for decision-making.<ul class="elsevierStyleList" id="lis0100"><li class="elsevierStyleListItem" id="lsti0165">•In patients with PE provoked by surgical transient risk factors, 3 months of anticoagulant treatment is recommended.</li><li class="elsevierStyleListItem" id="lsti0170">•In patients with PE provoked by non-surgical transient risk factors, 3 months anticoagulant treatment is suggested.</li><li class="elsevierStyleListItem" id="lsti0175">•In patients with unprovoked PE, a minimum of 3–6 months anticoagulant treatment is recommended, and it is suggested that indefinite treatment be assessed according to the balance between the risk of recurrence and the risk of bleeding.</li><li class="elsevierStyleListItem" id="lsti0180">•In patients with cancer, at least 3–6 months anticoagulant treatment is recommended, and it is suggested that the treatment be prolonged while the cancer is active.</li><li class="elsevierStyleListItem" id="lsti0185">•Indefinite anticoagulant treatment is recommended in patients with a second episode of unprovoked PE.</li><li class="elsevierStyleListItem" id="lsti0190">•In patients with an indication for indefinite anticoagulation, periodical reevaluation of this indication is recommended.</li></ul>Individual Markers for Risk of Recurrence in Unprovoked Pulmonary EmbolismEvent presentation. In a meta-analysis that included 2554 patients with PE or DVT who were followed-up for 5 years, the initial presentation of the thrombotic event as PE tripled the risk that the recurrent VTE was again a PE (vs DVT) (HR 3.1, 95% CI, 1.9–5.1).<a class="elsevierStyleCrossRef" href="#bib0220">44</a> These results highlight the importance of presentation of the event, since the mortality of PE is significantly higher than that of DVT.D-dimer. In the PROLONG<a class="elsevierStyleCrossRef" href="#bib0225">45</a> trial, D-dimer was measured 1 month after discontinuing anticoagulant therapy in patients with a first episode of unprovoked VTE who had received at least 3 months VKA treatment. Patients with negative D-dimer did not receive anticoagulant therapy, while those with positive D-dimer were randomized to restart or discontinue anticoagulant therapy definitively. The rate of recurrent VTE during follow-up was 15% in the group with positive D-dimer who stopped anticoagulant treatment, 6.2% in the group with negative D-dimer, and 2.6% in the group with positive D-dimer who received anticoagulant treatment. These results have been confirmed in subsequent systematic reviews and meta-analyses.Residual deep vein thrombosis. Residual DVT is defined as persistence of the organized thrombus adhered to the vein wall over time. In a systematic review and meta-analysis of 9 cohort studies and 5 randomized trials,<a class="elsevierStyleCrossRef" href="#bib0230">46</a> it was concluded that residual DVT was modestly associated with an increase in the risk of recurrence for all patients with DVT (both provoked and unprovoked) (OR 1.5; 95%, CI 1.1–2.0), but the effect disappeared when only the subgroup of patients with unprovoked DVT was considered (OR 1.2; 95% CI, 0.9–1.7). Its limitation is that the evaluation is operator-dependent and interobserver variability is high.First vs second episode of PE. After a second episode of VTE, the risk of recurrence is approximately 1.5 times higher than after the first episode.<a class="elsevierStyleCrossRef" href="#bib0235">47</a> The risk of recurrence is particularly high when the second episode occurs shortly after discontinuing anticoagulant therapy.Hereditary and acquired thrombophilia. In a meta-analysis, the risk of recurrent VTE was 1.6 (95% CI, 1.1–2.1) for patients heterozygous for factor V Leiden (1.2; 95% CI, 0.6–2.2, for the subgroup of patients with unprovoked VTE), 2.6 (95% CI, 1.2–6.0) for homozygous patients, and 1.4 (95% CI, 1.0–2.2) for patients heterozygous for the prothrombin G20210A gene.<a class="elsevierStyleCrossRef" href="#bib0240">48</a> Given that the association between hereditary thrombophilia and the risk of recurrence is weak (if it exists), its measurement to determine the duration of anticoagulant treatment is not recommended.Studies that have evaluated the association between the presence of antiphospholipid antibodies (APA) and the risk of recurrent VTE do not provide consistent data for deciding the duration of anticoagulation if they are detected.Other risk factors of recurrence. Advanced age, male gender, obesity, post-thrombotic syndrome secondary to DVT concomitant with PE, some anti-psychotic drugs and certain chronic diseases such as inflammatory bowel disease have been associated with an increased risk of recurrence when anticoagulant treatment is discontinued.Predictive Models of Recurrence for Patients With Unprovoked Pulmonary EmbolismVarious predictive models have been developed that could identify patients with unprovoked PE and low risk of recurrence. However, none have been prospectively validated. The most widely used models are the DASH (D-Dimer, Age, Sex, Hormonal treatment) score,<a class="elsevierStyleCrossRef" href="#bib0245">49</a> Vienna nomogram,<a class="elsevierStyleCrossRef" href="#bib0250">50</a> developed with 3 variables associated independently with the risk of recurrence: female sex, proximal DVT vs PE and D-dimer value determined after discontinuation of anticoagulant treatment, and the Canadian model,<a class="elsevierStyleCrossRef" href="#bib0255">51</a> valid for women, which includes the following variables: age, body mass index, D-dimer determined after discontinuing anticoagulant treatment and presence of post-thrombotic symptoms or signs in the LE.Drugs For Long-Term TreatmentThese guidelines only make recommendations or suggestions for drugs approved in Spain for this indication.Vitamin K AntagonistsAcenocumarol and warfarin are the two dicumarol derivatives available in Spain. They interfere competitively in the metabolism of vitamin K and inhibit the production of coagulation proteins dependent on this vitamin (factors II, VII, IX and X and proteins C, S and Z). Acenocumarol has a shorter half-life and faster metabolic clearance than warfarin. Control of the therapeutic action requires monitoring expressed as the international normalized ratio (INR). An INR range between 2.0 and 3.0 has the best balance between efficacy and safety,<a class="elsevierStyleCrossRef" href="#bib0260">52</a> and reduces the risk of recurrence by 80%. After having completed a minimum of 6 months with a range between 2.0 and 3.0, a clinical trial found that the administration of VKA with a lower range, between 1.5 and 1.9, reduced the risk of recurrence by 64% (HR 0.36; 95% CI, 0.19–0.67) without increasing the risk of major bleeding (HR 2.53; 95% CI, 0.49–13.03).<a class="elsevierStyleCrossRef" href="#bib0265">53</a> In another clinical trial, when this regimen (range between 1.5 and 1.9) was compared with the conventional regimen (range between 2.0 and 3.0), the risk of recurrence was significantly higher (HR 2.8; 95% CI, 1.1–7.0), with no differences in the risk of major bleeding (HR 1.2; 95% CI, 0.4–3.0).<a class="elsevierStyleCrossRef" href="#bib0260">52</a>In patients with difficulty in regular monitoring or maintaining a stable INR with VKA (more than 50% of measurements within range over a 6-month period), the balance between efficacy and safety of VKA is not guaranteed.Low Molecular Weight HeparinsThese are indicated for at least the first 3 months of treatment of VTE in patients with active cancer, where they have been shown to be more effective than VKAs. However, as the doses for long-term treatment are not well established and their administration is parenteral, their use is not recommended as first choice in patients with VTE not secondary to cancer, although they could be an alternative for patients with difficulty in properly controlling VKA levels or unstable INR.New Oral AnticoagulantsAt the time of writing of this consensus, the European Medicines Agency (EMA) has only approved rivaroxaban for the secondary prevention of VTE after a first episode of DVT or PE. Other anticoagulants, such as dabigatran or apixaban, already marketed for other indications, are pending approval.The Einstein-Extension study<a class="elsevierStyleCrossRef" href="#bib0135">27</a> randomly assigned 1197 patients who had completed 6–12 months of anticoagulation (with VKA or rivaroxaban) to receive rivaroxaban at doses of 20mg/day or placebo. During the study period, rivaroxaban significantly reduced the risk of recurrent VTE (HR 0.18; 95% CI, 0.09–0.39). There were no significant differences in the incidence of major bleeding, but rivaroxaban increased the risk of major or clinically relevant non-major bleeding (HR 5.19; IC 95%, 2.3–11.7).In the AMPLIFY-EXT trial,<a class="elsevierStyleCrossRef" href="#bib0270">54</a> two doses of apixaben (2.5 and 5mg, twice daily) were compared with placebo in patients with VTE who had completed 6–12 months of anticoagulant treatment (with VKA or apixaban). During the study period, apixaban significantly reduced the risk of recurrent VTE (relative risk [RR] 0.19; 95% CI, 0.11–0.33 for the 2.5mg dose; RR 0.20; 95% CI, 0.11–0.34 for the 5mg dose), with no differences in the incidence of major or clinically relevant non-major bleeding (RR 1.20; 95% CI, 0.69–2.10 for the 2.5mg dose; RR 1.62; 95% CI, 0.96–2.73 for the 5mg dose).In two clinical trials, RE-MEDY and RE-SONATE,<a class="elsevierStyleCrossRef" href="#bib0275">55</a> dabigatran at a dose of 150mg twice daily was compared with VKA and placebo (respectively) in patients with VTE who had completed at least 3 months of anticoagulation (with VKA or dabigatran). During the study period, dabigatran was equally as effective as the VKAs (HR 1.44; 95% CI, 0.78–2.64) and more effective than placebo (HR 0.08; 95% CI, 0.02–0.25) in reducing recurrent VTE. Dabigatran reduced the total incidence of major or clinically relevant non-major bleeding when compared with VKA (HR 0.54; 95% CI, 0.41–0.71), but these increased when compared with placebo (HR 2.92; 95% CI, 1.52–5.60).AspirinTwo clinical trials were published in 2012, WARFASA<a class="elsevierStyleCrossRef" href="#bib0280">56</a> and ASPIRE,<a class="elsevierStyleCrossRef" href="#bib0285">57</a> which evaluated the efficacy and safety of aspirin compared to placebo in the secondary prevention of VTE in patients with a first unprovoked episode of PE or DVT. In the WARFASA study, aspirin was compared to placebo in patients with VTE who had completed a 6–18-month period of treatment with VKA (DVT 63%; PE 37%). During the 2 years of follow-up, aspirin significantly reduced the risk of recurrent VTE (HR 0.55; 95% CI, 0.33–0.92), without increasing bleeding episodes (HR 0.98; 95% CI, 0.24–3.96). In the ASPIRE study, aspirin was compared to placebo in patients with VTE who had completed a 6-week to 24-month period of treatment with VKA. No differences were observed in the rate of recurrent VTE (HR 0.74; 95% CI, 0.52–1.09), although there was an overall clinical benefit in the reduction of the composite of cardiovascular episodes, bleeding, and death from any cause (HR 0.67; 95% CI, 0.49–0.91).<ul class="elsevierStyleList" id="lis0105"><li class="elsevierStyleListItem" id="lsti0195">•The use of VKA is recommended for most patients with PE, with a target INR of 2.5 (range 2.0–3.0), for long-term anticoagulant treatment.</li><li class="elsevierStyleListItem" id="lsti0200">•It is suggested not to use VKA with a target INR of 1.5–1.9 for long-term anticoagulant treatment.</li><li class="elsevierStyleListItem" id="lsti0205">•The use of LMWH is recommended for patients with PE secondary to cancer throughout treatment.</li><li class="elsevierStyleListItem" id="lsti0210">•The use of rivaroxaban for long-term anticoagulant treatment is suggested in patients with difficulty in regular monitoring or maintaining a stable INR with VKA.</li><li class="elsevierStyleListItem" id="lsti0215">•In patients with unprovoked PE in whom oral anticoagulation has been discontinued, it is suggested to assess the use of aspirin, at a dose of 100mg/day, once the minimum treatment duration (3 months) has been completed.</li></ul>Residual Thrombosis and Chronic Thromboembolic Pulmonary HypertensionIn a review of 4 studies in which serial imaging tests were carried out, the percentage of patients with residual PE was 87% at 8 days, 68% at 6 weeks, 65% at 3 months, 57% at 6 months and 52% at 11 months.<a class="elsevierStyleCrossRef" href="#bib0290">58</a> However, in a study of 673 patients from a single center who were followed-up for 3 months, the rate of symptomatic recurrent VTE was only 3%.<a class="elsevierStyleCrossRef" href="#bib0295">59</a> Therefore, there is disagreement between the percentage of patients with residual thrombosis and the percentage of patients with recurrent VTE.The incidence of symptomatic chronic thromboembolic pulmonary hypertension (CTEPH) in patients who have had an episode of PE varies according to the series and follow-up period, and has reached up to 3.8%.<a class="elsevierStyleCrossRef" href="#bib0300">60</a> Some characteristics of the initial PE episode (age >70 years, young age, female gender, pulmonary systolic pressure >50mmHg, massive or sub-massive PE, recurrent or idiopathic PE) increase the risk of developing CTEPH.<a class="elsevierStyleCrossRef" href="#bib0305">61</a><ul class="elsevierStyleList" id="lis0110"><li class="elsevierStyleListItem" id="lsti0220">•In patients with a history of PE, it is recommended not to use thoracic imaging tests to evaluate the persistence of residual thrombosis or reperfusion of the initial defects.</li><li class="elsevierStyleListItem" id="lsti0225">•In patients with a history of PE and signs or symptoms suggestive of CTEPH, it is recommended to perform a follow-up transthoracic echocardiogram.</li></ul>Search for Occult Neoplasm in Unprovoked Pulmonary EmbolismVTE is associated with an occult neoplasm in approximately 10% of patients. The Trousseau study<a class="elsevierStyleCrossRef" href="#bib0310">62</a> compared the utility of extensive screening for cancer by thoracoabdominal CT and mammography (in women) with limited screening. The results did not show any differences in the incidence of cancer or mortality between the two patient groups. Extensive screening significantly increased the healthcare costs due to the additional diagnostic process associated with false positive results.<ul class="elsevierStyleList" id="lis0115"><li class="elsevierStyleListItem" id="lsti0230">•In patients with an episode of unprovoked PE, it is suggested not to perform specific tests searching for neoplasia if there are no clinical symptoms or basic complementary examinations that suggest the presence of this disease.</li></ul>Conflicts of InterestFernando Uresandi has received funding for giving lectures at educational events and/or scientific advice and/or research from Bayer HealthCare Pharmaceuticals.Manuel Monreal has received funding for giving lectures at educational events and/or scientific advice and/or research from Bayer HealthCare Pharmaceuticals; Boehringer Ingelheim Pharmaceuticals, Inc.; Daiichi Sankyo, Inc; Pfizer; ROVI; Sanofi-Aventis.Ferrán García-Bragado has received funding for giving lectures at educational events and/or scientific advice and/or research from Bayer HealthCare Pharmaceuticals; Boehringer Ingelheim Pharmaceuticals, Inc.; Bristol-Myers Squibb Company; Daiichi Sankyo, Inc; ROVI; Sanofi-Aventis.Ramón Lecumberri has received funding for giving lectures at educational events and/or scientific advice and/or research from Bayer HealthCare Pharmaceuticals; Boehringer Ingelheim Pharmaceuticals, Inc.; Bristol-Myers Squibb Company; Leo Pharma; ROVI; Sanofi-Aventis.Sonia Jiménez has received funding for giving lectures at educational events and/or scientific advice and/or research from Bayer HealthCare Pharmaceuticals; Boehringer Ingelheim Pharmaceuticals, Inc.; ROVI; Sanofi-Aventis.Pedro Ruiz-Artacho has received funding for giving lectures at educational events and/or scientific advice and/or research from Bayer HealthCare Pharmaceuticals; LeoPharma; Sanofi-Aventis.Francisco Lozano has received funding for giving lectures at educational events and/or scientific advice and/or research from Bayer HealthCare Pharmaceuticals; Bristol-Myers Squibb Company; Leo Pharma; ROVI; Sanofi-Aventis.Antonio Romera has received funding for giving lectures at educational events and/or scientific advice and/or research from Bayer HealthCare Pharmaceuticals; Leo Pharma; ROVI; Sanofi-Aventis.David Jiménez has received funding for giving lectures at educational events and/or scientific advice and/or research from Bayer HealthCare Pharmaceuticals; Boehringer Ingelheim Pharmaceuticals, Inc.; Bristol-Myers Squibb Company; Daiichi Sankyo, Inc; Leo Pharma; ROVI; Sanofi-Aventis.Pere Domenech has received funding for giving lectures at educational events and/or scientific advice and/or research from Bayer HealthCare Pharmaceuticals; Boehringer Ingelheim Pharmaceuticals, Inc.; Bristol-Myers Squibb Company; Leo Pharma; ROVI; Sanofi-Aventis." "textoCompletoSecciones" => array:1 [ "secciones" => array:8 [ 0 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 1 => array:2 [ "identificador" => "sec0010" "titulo" => "Concept, Pathogenesis, Risk Factors and Epidemiology" ] 2 => array:3 [ "identificador" => "sec0015" "titulo" => "Diagnosis" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0225" "titulo" => "Clinical Suspicion" ] 1 => array:2 [ "identificador" => "sec0025" "titulo" => "D-Dimer" ] 2 => array:3 [ "identificador" => "sec0030" "titulo" => "Imaging Tests" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "sec0035" "titulo" => "Multidetector Computed Tomography Angiography" ] 1 => array:2 [ "identificador" => "sec0040" "titulo" => "Lung Scintigraphy" ] 2 => array:2 [ "identificador" => "sec0045" "titulo" => "Lower Extremity Venous Ultrasound" ] 3 => array:2 [ "identificador" => "sec0050" "titulo" => "Pulmonary Magnetic Resonance Angiography" ] 4 => array:2 [ "identificador" => "sec0055" "titulo" => "Transthoracic Echocardiography" ] ] ] ] ] 3 => array:3 [ "identificador" => "sec0060" "titulo" => "Prognostic Stratification of Patients With Pulmonary Embolism" "secciones" => array:3 [ 0 => array:2 [ "identificador" => "sec0065" "titulo" => "Prognostic Factors" ] 1 => array:2 [ "identificador" => "sec0070" "titulo" => "Identification of Patients With Low-Risk Pulmonary Embolism" ] 2 => array:2 [ "identificador" => "sec0075" "titulo" => "Identification of Patients With Intermediate-Risk Pulmonary Embolism" ] ] ] 4 => array:3 [ "identificador" => "sec0080" "titulo" => "Treatment of Pulmonary Embolism in the Initial Phase (Acute Phase And up to 3–6 Months)" "secciones" => array:12 [ 0 => array:2 [ "identificador" => "sec0085" "titulo" => "Anticoagulation With Unfractionated Heparin, Low Molecular Weight Heparins or Fondaparinux" ] 1 => array:2 [ "identificador" => "sec0090" "titulo" => "Beginning Oral Anticoagulation" ] 2 => array:2 [ "identificador" => "sec0095" "titulo" => "New Oral Anticoagulants" ] 3 => array:2 [ "identificador" => "sec0100" "titulo" => "Early vs Standard Discharge in Pulmonary Embolism Patients" ] 4 => array:2 [ "identificador" => "sec0105" "titulo" => "Early Mobilization vs Rest in Acute Pulmonary Embolism" ] 5 => array:2 [ "identificador" => "sec0110" "titulo" => "Fibrinolytic Treatment" ] 6 => array:2 [ "identificador" => "sec0115" "titulo" => "Vena Caval Filters" ] 7 => array:2 [ "identificador" => "sec0120" "titulo" => "Other Treatments" ] 8 => array:2 [ "identificador" => "sec0125" "titulo" => "Support Treatment" ] 9 => array:2 [ "identificador" => "sec0130" "titulo" => "Treatment of Isolated Subsegmental Pulmonary Embolism" ] 10 => array:2 [ "identificador" => "sec0135" "titulo" => "Treatment of Incidental Pulmonary Embolism" ] 11 => array:2 [ "identificador" => "sec0140" "titulo" => "Treatment of Right-Sided Heart Thrombi" ] ] ] 5 => array:3 [ "identificador" => "sec0145" "titulo" => "Long-term Treatment of Pulmonary Thromboembolism (After the First 3–6 Months)" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "sec0150" "titulo" => "Duration of Treatment" ] 1 => array:3 [ "identificador" => "sec0155" "titulo" => "Risk of Recurrence" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "sec0160" "titulo" => "Bleeding Risk" ] 1 => array:2 [ "identificador" => "sec0165" "titulo" => "Decision Strategies" ] 2 => array:2 [ "identificador" => "sec0170" "titulo" => "Individual Markers for Risk of Recurrence in Unprovoked Pulmonary Embolism" ] 3 => array:2 [ "identificador" => "sec0175" "titulo" => "Predictive Models of Recurrence for Patients With Unprovoked Pulmonary Embolism" ] ] ] 2 => array:3 [ "identificador" => "sec0180" "titulo" => "Drugs For Long-Term Treatment" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "sec0185" "titulo" => "Vitamin K Antagonists" ] 1 => array:2 [ "identificador" => "sec0190" "titulo" => "Low Molecular Weight Heparins" ] 2 => array:2 [ "identificador" => "sec0195" "titulo" => "New Oral Anticoagulants" ] 3 => array:2 [ "identificador" => "sec0200" "titulo" => "Aspirin" ] ] ] 3 => array:2 [ "identificador" => "sec0205" "titulo" => "Residual Thrombosis and Chronic Thromboembolic Pulmonary Hypertension" ] 4 => array:2 [ "identificador" => "sec0210" "titulo" => "Search for Occult Neoplasm in Unprovoked Pulmonary Embolism" ] ] ] 6 => array:2 [ "identificador" => "sec0215" "titulo" => "Conflicts of Interest" ] 7 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2013-05-11" "fechaAceptado" => "2013-07-19" "NotaPie" => array:4 [ 0 => array:3 [ "etiqueta" => "1" "nota" => "General Coordinators: Fernando Uresandi and David Jimenez." "identificador" => "fn1" ] 1 => array:2 [ "etiqueta" => "☆" "nota" => "Please cite this article as: Uresandi F, Monreal M, García-Bragado F, Domenech P, Lecumberri R, Escribano P, et al. Consenso nacional sobre el diagnóstico, estratificación de riesgo y tratamiento de los pacientes con tromboembolia pulmonar. Arch Bronconeumol. 2013;49:534–547." ] 2 => array:2 [ "etiqueta" => "☆☆" "nota" => "In this consensus document have participated the following scientific societies: Spanish Society of Pneumology and Thoracic Surgery (SEPAR); Society Española Internal Medicine (SEMI); Spanish Society of Thrombosis and Haemostasis (SETH); Spanish Society of Cardiology (ESC); Spanish Society of Medicine Accident and Emergency (SEMES); Spanish Society of Angiology and Surgery Vascular (SEACV)." ] 3 => array:3 [ "etiqueta" => "2" "nota" => "A complete list of participating authors is available in the appendix." "identificador" => "fn2" ] ] "apendice" => array:1 [ 0 => array:1 [ "seccion" => array:1 [ 0 => array:4 [ "apendice" => "SEACV: Sergi Bellmunt, Jorge Cuenca, Álvaro Fernández, Fidel Fernández, Vicente Ibáñez, Francisco Lozano, José Ramón March, Antonio Romera; SEC: Luis Almenar, Antonio Castro, Pilar Escribano, María Lázaro, José Luis Zamorano; SEMES: José Ramón Alonso, José Ramón Casal, José Miguel Franco, Sonia Jiménez, Marta Merlo, Ramón Perales, Pascual Piñera, Pedro Ruiz-Artacho; Coral Suero; SEMI: Raquel Barba, Carmen Fernández-Capitán, Ferrán García-Bragado, Vicente Gómez, Manuel Monreal, José Antonio Nieto, Antoni Riera-Mestre, Carmen Suárez, Javier Trujillo-Santos; SEPAR: Francisco Conget, Luis Jara, David Jiménez, José Luis Lobo, Javier de Miguel, Dolores Nauffal, Mikel Oribe, Remedios Otero, Fernando Uresandi; SETH: Pere Domenech, José Ramón González-Porras, Ramón Lecumberri, Pilar Llamas, Eva Mingot, Elena Pina, Javier Rodríguez-Martorell." "etiqueta" => "Appendix I" "titulo" => "Participating authors (alphabetical order)" "identificador" => "sec0220" ] ] ] ] "multimedia" => array:13 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 4041 "Ancho" => 2253 "Tamanyo" => 312359 ] ] "descripcion" => array:1 [ "en" => "Diagnostic algorithm for the hemodynamically stable outpatient. (A) Angio-CT, computed tomography angiography. 1Refers to high sensitivity D-dimer. In the case of less sensitive D-dimer, PE can only be ruled out in patients with low clinical probability or PE unlikely. 2In case of high clinical probability and negative multidetector angio-CT, additional diagnostic tests are suggested (V/Q scan and/or Doppler ultrasound of lower extremities). (B) DVT, deep vein thrombosis. 1Refers to low or intermediate probability V/Q scans. 2In case of high clinical probability, inconclusive perfusion scan, and negative ultrasound of lower extremities, the need for multidetector angio-CT should be assessed with the appropriate specialist." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1862 "Ancho" => 2503 "Tamanyo" => 187810 ] ] "descripcion" => array:1 [ "en" => "Diagnostic algorithm for the hemodynamically unstable patient with suspected pulmonary embolism. Angio-CT, computed tomography angiography; PE, pulmonary embolism; RV, right ventricle." ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2263 "Ancho" => 3137 "Tamanyo" => 354485 ] ] "descripcion" => array:1 [ "en" => "Prognostic stratification and treatment of acute pulmonary embolism. *Cardiogenic shock or sustained systolic blood pressure <90mmHg, not due to hypovolemia, sepsis or cardiac arrhythmias. The broken line indicates absence of definitive evidence (fibrinolysis) or extensive clinical experience (rivaroxaban). For situations not considered in the algorithm, hospitalization and conventional anticoagulant therapy is recommended. BNP, brain natriuretic peptide; DVT, deep vein thrombosis; Fx, fondaparinux; HFABP, heart fatty acid binding protein; hsTnT, high sensitivity troponin T; ICU, intensive care unit; LMWH, low molecular weight heparin; PE, pulmonary embolism; PESI, Pulmonary Embolism Severity Index; RVD, right ventricular dysfunction; sPESI, simplified PESI; UFH, unfractionated heparin." ] ] 3 => array:7 [ "identificador" => "fig0020" "etiqueta" => "Fig. 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 840 "Ancho" => 1621 "Tamanyo" => 66548 ] ] "descripcion" => array:1 [ "en" => "Risk of recurrence according to the pulmonary embolism precipitating factor." ] ] 4 => array:7 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "DVT, deep vein thrombosis; LE, lower extremities; PE, pulmonary embolism." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">High risk \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Hip or knee prosthesis or fracture \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Major surgery \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Multiple trauma \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Spinal damage \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Moderate risk \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Plaster cast immobilization of LE \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Stroke with paralysis of LE \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Puerperium \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Previous PE or DVT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Estrogenic drugs or devices \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Thrombophilia \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Cancer \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Chemotherapy \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anti-psychotic drugs \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Inflammatory bowel disease \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Knee arthroscopy \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Central venous catheters or devices \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Low risk \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Advanced age \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Laparoscopic surgery \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Bed rest >3 days \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Long trips of >6–8h \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Morbid obesity \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Varicose veins \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Pregnancy \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab431814.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Risk Factors for Venous Thromboembolism." ] ] 5 => array:7 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Chest X-ray \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Electrocardiogram \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Normal ≈50% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Normal ≈50% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Small pleural effusion \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Sinus tachycardia \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Opacities (areas of pulmonary infarction) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Right precordial T-wave inversion \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Hampton's hump \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Right bundle branch block \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Linear atelectasis \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">S1Q3T3 pattern \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Local oligaemia \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Cardiac arrhythmias \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Slight elevation of the hemidiaphragm \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Increase in pulmonary arteries \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Cardiomegaly \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab431812.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Chest X-ray and Electrocardiogram in Acute Symptomatic Pulmonary Embolism." ] ] 6 => array:7 [ "identificador" => "tbl0015" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "DVT, deep vein thrombosis; LE, lower extremities; PE, pulmonary embolism." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Score \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Wells Score</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Alternative diagnosis less likely than PE \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Signs or symptoms of DVT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">History of PE or DVT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.5 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Immobilization for at least 3 days or surgery in the previous month \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.5 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Heart rate >100 beats/min \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.5 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Hemoptysis \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Active cancer (treatment ongoing, within previous 6 months or palliative) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">For high sensitivity D-dimer:Low probability: <2 pointsIntermediate probability: 2–6 pointsHigh probability: ≥6 pointsFor lower sensitivity D-dimer:PE unlikely: ≤4 pointsPE likely: >4 points \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Geneva Score</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age >65 years \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Previous DVT or PE \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Surgery under general anesthesia or fracture ≤1 month \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Active cancer, solid or hematologic, or considered cured ≤1 year \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Unilateral lower limb pain \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Hemoptysis \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Heart rate 75–94 beats/min \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Heart rate ≥95 beats/min \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Pain on LE palpation and unilateral edema \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Low probability: 0–3 pointsIntermediate probability: 4–10 pointsHigh probability: ≥11 points \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab431811.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Scoring Scales for Grading the Clinical Likelihood of Acute Symptomatic Pulmonary Embolism." ] ] 7 => array:7 [ "identificador" => "tbl0020" "etiqueta" => "Table 4" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:3 [ "leyenda" => "ELFA, enzyme-linked fluorescence assay; ELISA, enzyme-linked immunosorbent assay." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Sensitivity \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Method \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Laboratory Test<a class="elsevierStyleCrossRef" href="#tblfn0005">*</a> \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">High \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ELISA (gold standard) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Asserachrom® (Diagnostica Stago)Dimertest Gold EIA® (Agen Biomedical) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ELFA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">VIDAS® (BioMerieux) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Latex-enhanced immunoturbidimetry \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IL test® (Instrumentation Laboratory, SpA)Liatest® (Diagnostica Stago)Auto Dimertest (Agen Biomedical) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Moderate \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Whole blood immunoassay (red cell agglutination) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SimpliRED® (Agen Biomedical) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Low \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Latex immunoagglutination \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Dimertest® (Agen Biomedical)D-Dimer test® (Diagnostica Stago) \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab431817.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0005" "etiqueta" => "*" "nota" => "Laboratory test generally used in Spain." ] ] ] "descripcion" => array:1 [ "en" => "D-Dimer Measurement Techniques for Acute Symptomatic Pulmonary Thromboembolism." ] ] 8 => array:7 [ "identificador" => "tbl0025" "etiqueta" => "Table 5" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:3 [ "leyenda" => "Angio-CT, computed tomography angiography; BNP, brain natriuretic peptide; cTnI, cardiac troponin I; cTnT, cardiac troponin T; DVT, deep vein thrombosis; HFABP, heart fatty acid binding protein; hsTnT, high sensitivity troponin T; PESI, Pulmonary Embolism Severity Index." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Clinical markers \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">PESI ScoreSimplified PESI Score \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Markers of right ventricular dysfunction \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Transthoracic echocardiographyAngio-CTBNP or NT-proBNP<a class="elsevierStyleCrossRef" href="#tblfn0010">*</a> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Markers of thrombotic burden \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Residual DVTD-Dimer<a class="elsevierStyleCrossRef" href="#tblfn0010">*</a> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Markers of tissue damage \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Lactate<a class="elsevierStyleCrossRef" href="#tblfn0010">*</a> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Markers of myocardial damage \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">cTnI or cTnT<a class="elsevierStyleCrossRef" href="#tblfn0010">*</a>hsTnT<a class="elsevierStyleCrossRef" href="#tblfn0010">*</a>HFABP<a class="elsevierStyleCrossRef" href="#tblfn0010">*</a> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab431818.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0010" "etiqueta" => "*" "nota" => "Measurement methods and cut-off points according to local practices." ] ] ] "descripcion" => array:1 [ "en" => "Prognostic Tools for Hemodynamically Stable Patients With Acute Symptomatic Pulmonary Embolism." ] ] 9 => array:7 [ "identificador" => "tbl0030" "etiqueta" => "Table 6" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Variable \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Points \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">PESI Score (Pulmonary Embolism Severity Index)</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1/year \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Male gender \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Cancer \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">30 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Heart failure \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Chronic lung disease \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">10 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Heart rate ≥110 beats/min \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">20 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Systolic blood pressure <100mmHg \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">30 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Respiratory rate ≥30 breaths/min \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">20 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Temperature <36°C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">20 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Altered mental status \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">O2saturation <90% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">20 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Risk stratification:Class I (very low risk): <65 pointsClass II (low risk): 66–85 pointsClass III (intermediate risk): 86–105 pointsClass IV (high risk): 106–125 pointsClass V (very high risk): >125 points \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Simplified PESI Score</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age >80 years \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Cancer \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Chronic cardiopulmonary disease \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Heart rate ≥110 beats/min \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Systolic blood pressure <100mmHg \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">O2saturation <90% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Risk stratification:Low risk: 0 pointsHigh risk: ≥1 point(s) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab431813.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Prognostic Scores in Patients With Acute Symptomatic Pulmonary Embolism." ] ] 10 => array:7 [ "identificador" => "tbl0035" "etiqueta" => "Table 7" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:3 [ "leyenda" => "IU, international units; rt-P, recombinant tissue plasminogen activator." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Active substance \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Dose \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Interval \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Bemiparin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">115IU/kg \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Every 24h \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Dalteparin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">100IU/kg200IU/kg \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Every 12hEvery 24h \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Enoxaparin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.0mg/kg1.5mg/kg \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Every 12hEvery 24h \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Nadroparin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">85.5IU/kg171IU/kg \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Every 12hEvery 24h \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tinzaparin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">175IU/kg \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Every 24h \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Fondaparinux \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5.0mg (<50kg)7.5mg (50–100kg)10mg (>100kg) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Every 24h \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Rivaroxaban \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">15mg (days 1–21)20mg (starting from day 22) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Every 12hEvery 24h \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Unfractionated heparin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">18U/kg/h \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Perfusion \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">rt-PA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">100mg0.6mg/kg \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">In 2hIn 15min \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Urokinase \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3 million IU \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">In 2h \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Streptokinase \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.5 million IU \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">In 2h \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab431810.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0015" "etiqueta" => "*" "nota" => "Only drugs with approval for this indication are included." ] ] ] "descripcion" => array:1 [ "en" => "Treatment Guidelines for the Acute Phase of Pulmonary Embolism.<a class="elsevierStyleCrossRef" href="#tblfn0015">*</a>" ] ] 11 => array:7 [ "identificador" => "tbl0040" "etiqueta" => "Table 8" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "DVT, deep vein thrombosis; PE, pulmonary embolism; RIETE, Computerized Registry of Patients with Venous Thromboembolism." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">RIETE Score \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Score \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Recent major bleed (1 month) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Creatinine >1.2mg/dl \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.5 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anemia \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.5 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Cancer \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Clinical presentation as PE (vs DVT) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age >75 years \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="2" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Low risk: 0–3 pointsIntermediate risk: 1–4 pointsHigh risk: >4 points \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab431816.png" ] ] ] ] "descripcion" => array:1 [ "en" => "RIETE Score for Bleeding Risk in Patients With Venous Thromboembolism During the First 3 Months of Anticoagulant Treatment." ] ] 12 => array:7 [ "identificador" => "tbl0045" "etiqueta" => "Table 9" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:3 [ "leyenda" => "ACCP, American College of Chest Physicians." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Variable \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age >65 years \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age >75 years \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Previous bleed \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Cancer \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Cancer with metastasis \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Renal failure \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Liver failure \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Thrombocytopenia \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Previous stroke \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Diabetes \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anemia \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Anti-platelet therapy \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Poorly controlled anticoagulation \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Comorbidity and reduced functional capacity \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Recent surgery \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Frequent falls \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Alcohol abuse \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Low risk: 0 risk factorsModerate risk: 1 risk factorHigh risk: ≥2 risk factors \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab431815.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0020" "etiqueta" => "*" "nota" => "Adapted from Ref.<a class="elsevierStyleCrossRef" href="#bib0005">1</a>" ] ] ] "descripcion" => array:1 [ "en" => "ACCP Score for Bleeding Risk in Patients on Anticoagulant Therapy for More Than 3 Months Due to Venous Thromboembolic Disease.<a class="elsevierStyleCrossRef" href="#tblfn0020">*</a>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:62 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Antithrombotic therapy for VTE disease: antithrombotic therapy and prevention of thrombosis, 9th ed: American College of Chest Physicians Evidence-Based Clinical Practice Guidelines" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C. Kearon" 1 => "E.A. Akl" 2 => "A.J. Comerota" 3 => "P. Prandoni" 4 => "H. Bounameaux" 5 => "S.Z. Goldhaber" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Chest" "fecha" => "2012" "volumen" => "141" "paginaInicial" => "419S" "paginaFinal" => "494S" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "National Institute for Health and Clinical Excellence. CG144 venous thromboembolic diseases: the management of venous thromboembolic diseases and the role of thrombophilia testing. NICE clinical guidelines 2012 [accessed Feb 2013]. Available at: <a id="intr0010" class="elsevierStyleInterRef" href="http://www.nice.org.uk/guidance/cg">www.nice.org.uk/guidance/cg</a>." ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "An official ATS statement: grading the quality of evidence and strength of recommendations in ATS guidelines and recommendations" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H.J. Schünemann" 1 => "R. Jaeschke" 2 => "D.J. Cook" 3 => "W.F. Bria" 4 => "A.A. El-Solh" 5 => "A. Ernst" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1164/rccm.200602-197ST" "Revista" => array:6 [ "tituloSerie" => "Am J Respir Crit Care Med" "fecha" => "2006" "volumen" => "174" "paginaInicial" => "605" "paginaFinal" => "614" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16931644" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Appropriateness of diagnostic management and outcomes of suspected pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "P.M. Roy" 1 => "G. Meyer" 2 => "B. Vielle" 3 => "C. le Gall" 4 => "F. Verschuren" 5 => "F. Carpentier" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Ann Intern Med" "fecha" => "2006" "volumen" => "144" "paginaInicial" => "157" "paginaFinal" => "164" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16461959" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "VIDAS D-dimer in combination with clinical pre-test probability to rule out pulmonary embolism. A systematic review of management outcome studies" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Carrier" 1 => "M. Righini" 2 => "R.K. Djurabi" 3 => "M.V. Huisman" 4 => "A. Perrier" 5 => "P.S. Wells" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Thromb Haemost" "fecha" => "2009" "volumen" => "101" "paginaInicial" => "886" "paginaFinal" => "892" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19404542" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Safety of ruling out acute pulmonary embolism by normal computed tomography in patients with an indication for computed tomography: systematic review and meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "I.C. Mos" 1 => "F.A. Klok" 2 => "L.J. Kroft" 3 => "A. de Roos" 4 => "O.M. Dekkers" 5 => "M.V. Huisman" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1538-7836.2009.03518.x" "Revista" => array:6 [ "tituloSerie" => "J Thromb Haemost" "fecha" => "2009" "volumen" => "7" "paginaInicial" => "1491" "paginaFinal" => "1498" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19552684" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multidetector computed tomography for acute pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "P.D. Stein" 1 => "S.E. Fowler" 2 => "L.R. Goodman" 3 => "A. Gottschalk" 4 => "C.A. Hales" 5 => "R.D. Hulla" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa052367" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2006" "volumen" => "354" "paginaInicial" => "2317" "paginaFinal" => "2327" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16738268" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "Radiological Society of North America 2013 [accessed Feb 2013]. Available at: <a id="intr0015" class="elsevierStyleInterRef" href="http://www.radiologyinfo.org/">www.radiologyinfo.org</a>." ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "American Thoracic Society documents: an official American Thoracic Society/Society of Thoracic Radiology Clinical Practice guideline evaluation of suspected pulmonary embolism in pregnancy" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A.N. Leung" 1 => "T.M. Bull" 2 => "R. Jaeschke" 3 => "C.J. Lockwood" 4 => "P.M. Boiselle" 5 => "L.M. Hurwitz" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1148/radiol.11114045" "Revista" => array:6 [ "tituloSerie" => "Radiology" "fecha" => "2012" "volumen" => "262" "paginaInicial" => "635" "paginaFinal" => "646" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22282185" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Value of the ventilation/perfusion scan in acute pulmonary embolism. Results of the prospective investigation of pulmonary embolism diagnosis (PIOPED)" "autores" => array:1 [ 0 => array:2 [ "colaboracion" => "The PIOPED Investigators" "etal" => false ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Am Med Assoc" "fecha" => "1990" "volumen" => "263" "paginaInicial" => "2753" "paginaFinal" => "2759" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Gadolinium-enhanced magnetic resonance angiography for pulmonary embolism: a multicenter prospective study (PIOPED III)" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "P.D. Stein" 1 => "T.L. Chenevert" 2 => "S.E. Fowler" 3 => "L.R. Goodman" 4 => "A. Gottschalk" 5 => "C.A. Hales" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.7326/0003-4819-152-7-201004060-00008" "Revista" => array:6 [ "tituloSerie" => "Ann Intern Med" "fecha" => "2010" "volumen" => "152" "paginaInicial" => "434" "paginaFinal" => "443" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20368649" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Acute pulmonary embolism: clinical outcomes in the International Cooperative Pulmonary Embolism Registry" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "S.Z. Goldhaber" 1 => "L. Visani" 2 => "M. de Rosa" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Lancet" "fecha" => "1999" "volumen" => "353" "paginaInicial" => "24" "paginaFinal" => "27" ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Risk stratification of normotensive patients with acute pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "D. Jiménez" 1 => "D. Aujesky" 2 => "R.D. Yusen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-2141.2010.08406.x" "Revista" => array:6 [ "tituloSerie" => "Br J Haematol" "fecha" => "2010" "volumen" => "151" "paginaInicial" => "415" "paginaFinal" => "424" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20955409" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Derivation and validation of a prognostic model for pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Aujesky" 1 => "D.S. Obrosky" 2 => "R.A. Stone" 3 => "T.E. Auble" 4 => "A. Perrier" 5 => "J. Cornuz" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1164/rccm.200506-862OC" "Revista" => array:6 [ "tituloSerie" => "Am J Respir Crit Care Med" "fecha" => "2005" "volumen" => "172" "paginaInicial" => "1041" "paginaFinal" => "1046" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16020800" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Simplification of the Pulmonary Embolism Severity Index for prognosticating patients with acute symptomatic pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Jiménez" 1 => "D. Aujesky" 2 => "L. Moores" 3 => "V. Gómez" 4 => "J.L. Lobo" 5 => "F. Uresandi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1001/archinternmed.2010.199" "Revista" => array:6 [ "tituloSerie" => "Arch Intern Med" "fecha" => "2010" "volumen" => "170" "paginaInicial" => "1383" "paginaFinal" => "1389" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20696966" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0080" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prognostic value of right ventricular dysfunction in patients with haemodynamically stable pulmonary embolism: A systematic review" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "O. Sanchez" 1 => "L. Trinquart" 2 => "I. Colombet" 3 => "P. Durieux" 4 => "M.V. Huisman" 5 => "G. Chatellier" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/eurheartj/ehn208" "Revista" => array:6 [ "tituloSerie" => "Eur Heart J" "fecha" => "2008" "volumen" => "29" "paginaInicial" => "1569" "paginaFinal" => "1577" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18495689" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0085" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "CT signs of right ventricular dysfunction: prognostic role in acute pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D.K. Kang" 1 => "C. Thilo" 2 => "J. Schoepf" 3 => "J.M. Barraza" 4 => "J.W. Nance" 5 => "G. Bastarrika" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Am Coll Cardiol Img" "fecha" => "2011" "volumen" => "4" "paginaInicial" => "841" "paginaFinal" => "849" ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0090" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Multidetector computed tomography for acute pulmonary embolism: diagnosis and risk stratification in a single test" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C. Becattini" 1 => "G. Agnelli" 2 => "M.C. Vedovati" 3 => "P. Pruszczyk" 4 => "F. Casazza" 5 => "S. Grifoni" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/eurheartj/ehr108" "Revista" => array:6 [ "tituloSerie" => "Eur Heart J" "fecha" => "2011" "volumen" => "32" "paginaInicial" => "1657" "paginaFinal" => "1663" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21504936" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0095" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prognostic value of troponins in acute pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "C. Becattini" 1 => "M.C. Vedovati" 2 => "G. Agnelli" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/CIRCULATIONAHA.106.680421" "Revista" => array:6 [ "tituloSerie" => "Circulation" "fecha" => "2007" "volumen" => "116" "paginaInicial" => "427" "paginaFinal" => "433" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17606843" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0100" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Troponin-based risk stratification of patients with nonmassive pulmonary embolism: systematic review and metaanalysis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Jiménez" 1 => "F. Uresandi" 2 => "R. Otero" 3 => "J.L. Lobo" 4 => "M. Monreal" 5 => "D. Martí" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1378/chest.09-0608" "Revista" => array:6 [ "tituloSerie" => "Chest" "fecha" => "2009" "volumen" => "136" "paginaInicial" => "974" "paginaFinal" => "982" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19465511" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0105" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "N-terminal pro-brain natriuretic peptide or troponin testing followed by echocardiography for risk stratification of acute pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L. Binder" 1 => "B. Pieske" 2 => "M. Olschewski" 3 => "A. Geibel" 4 => "B. Klostermann" 5 => "C. Reiner" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/CIRCULATIONAHA.105.552216" "Revista" => array:6 [ "tituloSerie" => "Circulation" "fecha" => "2005" "volumen" => "112" "paginaInicial" => "1573" "paginaFinal" => "1579" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16144990" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0110" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Brain-type natriuretic peptide levels in the prediction of adverse outcome in patients with pulmonary embolism: a systematic review and meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "F.A. Klok" 1 => "I.C. Mos" 2 => "M.V. Huisman" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1164/rccm.200803-459OC" "Revista" => array:6 [ "tituloSerie" => "Am J Respir Crit Care Med" "fecha" => "2008" "volumen" => "178" "paginaInicial" => "425" "paginaFinal" => "430" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18556626" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0115" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prognostic significance of concomitant deep vein thrombosis in patients presenting with acute symptomatic pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Jiménez" 1 => "D. Aujesky" 2 => "G. Díaz" 3 => "M. Monreal" 4 => "R. Otero" 5 => "D. Martí" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1164/rccm.200908-1204OC" "Revista" => array:6 [ "tituloSerie" => "Am J Respir Crit Care Med" "fecha" => "2010" "volumen" => "181" "paginaInicial" => "983" "paginaFinal" => "991" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20110556" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0120" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Low-molecular-weight or unfractionated heparin in venous thromboembolism: the influence of renal function" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Trujillo-Santos" 1 => "S. Schellong" 2 => "C. Falga" 3 => "V. Zorrilla" 4 => "P. Gallego" 5 => "M. Barrón" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.amjmed.2012.09.021" "Revista" => array:6 [ "tituloSerie" => "Am J Med" "fecha" => "2013" "volumen" => "126" "paginaInicial" => "425" "paginaFinal" => "434" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23499331" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0125" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Low-molecular-weight heparin compared with intravenous unfractionated heparin for treatment of pulmonary embolism. A meta-analysis of randomized, controlled trials" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "D.J. Quinlan" 1 => "A. McQuillan" 2 => "J.W. Eikelboom" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Ann Intern Med" "fecha" => "2004" "volumen" => "140" "paginaInicial" => "175" "paginaFinal" => "183" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14757615" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0130" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Subcutaneous fondaparinux versus intravenous unfractionated heparin in the initial treatment of pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "colaboracion" => "The Matisse Investigators" "etal" => false ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa035451" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2003" "volumen" => "349" "paginaInicial" => "1695" "paginaFinal" => "1702" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14585937" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0135" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Oral rivaroxaban for symptomatic venous thromboembolism" "autores" => array:1 [ 0 => array:2 [ "colaboracion" => "The EINSTEIN Investigators" "etal" => false ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa1007903" "Revista" => array:7 [ "tituloSerie" => "N Engl J Med" "fecha" => "2010" "volumen" => "363" "paginaInicial" => "2499" "paginaFinal" => "2510" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21128814" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0302283808010877" "estado" => "S300" "issn" => "03022838" ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0140" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Oral rivaroxaban for the treatment of symptomatic pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "colaboracion" => "The EINSTEIN-PE Investigators" "etal" => false ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa1113572" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2012" "volumen" => "366" "paginaInicial" => "1287" "paginaFinal" => "1297" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22449293" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0145" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Outpatient versus inpatient treatment for patients with acute pulmonary embolism: an international, open-label, randomised, non-inferiority trial" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Aujesky" 1 => "P.M. Roy" 2 => "F. Verschuren" 3 => "M. Righini" 4 => "J. Osterwalder" 5 => "M. Egloff" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/S0140-6736(11)60824-6" "Revista" => array:6 [ "tituloSerie" => "Lancet" "fecha" => "2011" "volumen" => "378" "paginaInicial" => "41" "paginaFinal" => "48" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21703676" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0150" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Oral apixaban for the treatment of acute venous thromboembolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "G. Agnelli" 1 => "H.R. Büller" 2 => "A. Cohen" 3 => "M. Curto" 4 => "A.S. Gallus" 5 => "M. Johnson" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa1302507" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2013" "volumen" => "369" "paginaInicial" => "799" "paginaFinal" => "808" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23808982" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0155" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Ambulation after deep vein thrombosis: a systematic review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "C.M. Anderson" 1 => "T.J. Overend" 2 => "J. Godwin" 3 => "C. Sealy" 4 => "A. Sunderji" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3138/physio.61.3.133" "Revista" => array:6 [ "tituloSerie" => "Physiother Can" "fecha" => "2009" "volumen" => "61" "paginaInicial" => "133" "paginaFinal" => "140" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20514175" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0160" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Combinations of prognostic tools for identification of high-risk normotensive patients with acute symptomatic pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Jiménez" 1 => "D. Aujesky" 2 => "L. Moores" 3 => "V. Gómez" 4 => "D. Martí" 5 => "S. Briongos" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/thx.2010.150656" "Revista" => array:6 [ "tituloSerie" => "Thorax" "fecha" => "2011" "volumen" => "66" "paginaInicial" => "75" "paginaFinal" => "81" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20978032" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0165" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:1 [ "titulo" => "The Urokinase Pulmonary Embolism Trial: a national cooperative study" ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Circulation" "fecha" => "1973" "volumen" => "47" "numero" => "Suppl" "paginaInicial" => "II1" "paginaFinal" => "II108" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/4266893" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0170" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Management of massive and submassive pulmonary embolism, iliofemoral deep vein thrombosis, and chronic thromboembolic pulmonary hypertension: a scientific statement from the American Heart Association" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.R. Jaff" 1 => "S.L. Archer" 2 => "M. Cushman" 3 => "N. Goldenberg" 4 => "S.Z. Goldhaber" 5 => "S. Jenkins" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/CIR.0b013e318214914f" "Revista" => array:6 [ "tituloSerie" => "Circulation" "fecha" => "2011" "volumen" => "123" "paginaInicial" => "1788" "paginaFinal" => "1830" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21422387" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0175" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Heparin plus alteplase compared with heparin alone in patients with submassive pulmonary embolism" "autores" => array:1 [ 0 => array:3 [ "colaboracion" => "Management Strategies and Prognosis of Pulmonary Embolism-3 Trial Investigators" "etal" => false "autores" => array:5 [ 0 => "S. Konstantinides" 1 => "A. Geibel" 2 => "G. Heusel" 3 => "F. Heinrich" 4 => "W. Kasper" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa021274" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2002" "volumen" => "347" "paginaInicial" => "1143" "paginaFinal" => "1150" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12374874" "web" => "Medline" ] ] ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0180" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Single-bolus tenecteplase plus heparin compared with heparin alone for normotensive patients with acute pulmonary embolism, who have evidence of right ventricular dysfunction and myocardial injury: rationale and design of the pulmonary embolism thrombolysis (PEITHO) trial" "autores" => array:1 [ 0 => array:2 [ "colaboracion" => "The Steering Committe, on behalf of the PEITHO investigators" "etal" => false ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ahj.2011.10.003" "Revista" => array:6 [ "tituloSerie" => "Am Heart J" "fecha" => "2012" "volumen" => "163" "paginaInicial" => "33" "paginaFinal" => "38" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22172434" "web" => "Medline" ] ] ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0185" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A clinical trial of vena cava filters in the prevention of pulmonary embolism in patients with proximal deep vein thrombosis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Decousus" 1 => "A. Leizorovicz" 2 => "F. Parent" 3 => "Y. Page" 4 => "B. Tardy" 5 => "P. Girard" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJM199802123380701" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "1998" "volumen" => "338" "paginaInicial" => "409" "paginaFinal" => "415" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9459643" "web" => "Medline" ] ] ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0190" "etiqueta" => "38" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Management of unsuccessful thrombolysis in acute massive pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "N. Meneveau" 1 => "M.F. Séronde" 2 => "M.C. Blonde" 3 => "P. Legalery" 4 => "K. Didier-Petit" 5 => "F. Briand" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1378/chest.129.4.1043" "Revista" => array:6 [ "tituloSerie" => "Chest" "fecha" => "2006" "volumen" => "129" "paginaInicial" => "1043" "paginaFinal" => "1050" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16608956" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0195" "etiqueta" => "39" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Subsegmental pulmonary embolism diagnosed by computed tomography: incidence and clinical implications. A systematic review and meta-analysis of the management outcome studies" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Carrier" 1 => "M. Righini" 2 => "P.S. Wells" 3 => "A. Perrier" 4 => "D.R. Anderson" 5 => "M.A. Rodger" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1538-7836.2010.03938.x" "Revista" => array:6 [ "tituloSerie" => "J Thromb Haemost" "fecha" => "2010" "volumen" => "8" "paginaInicial" => "1716" "paginaFinal" => "1722" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20546118" "web" => "Medline" ] ] ] ] ] ] ] ] 39 => array:3 [ "identificador" => "bib0200" "etiqueta" => "40" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Unsuspected pulmonary emboli adversely impact survival in patients with cancer undergoing routine staging multi-row detector computed tomography scanning" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C. O’Connell" 1 => "P. Razavi" 2 => "M. Ghalichi" 3 => "S. Boyle" 4 => "S. Vasan" 5 => "L. Mark" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1538-7836.2010.04114.x" "Revista" => array:6 [ "tituloSerie" => "J Thromb Haemost" "fecha" => "2011" "volumen" => "9" "paginaInicial" => "305" "paginaFinal" => "311" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20955348" …1 ] ] ] ] ] ] ] ] 40 => array:3 [ "identificador" => "bib0205" "etiqueta" => "41" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Influence of preceding length of anticoagulant treatment and initial presentation of venous thromboembolism on risk of recurrence after stopping treatment: analysis of individual participants’ data from seven trials" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Br Med J" "fecha" => "2011" "volumen" => "342" "paginaInicial" => "d3036" ] ] ] ] ] ] 41 => array:3 [ "identificador" => "bib0210" "etiqueta" => "42" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Risk of recurrence after a first episode of symptomatic venous thromboembolism provoked by a transient risk factor: a systematic review" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1001/archinternmed.2010.367" "Revista" => array:6 [ "tituloSerie" => "Arch Intern Med" "fecha" => "2010" "volumen" => "170" "paginaInicial" => "1710" "paginaFinal" => "1716" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 42 => array:3 [ "identificador" => "bib0215" "etiqueta" => "43" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Predictive variables for major bleeding events in patients presenting with documented acute venous thromboembolism. Findings from the RIETE Registry" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1160/TH08-03-0193" "Revista" => array:6 [ "tituloSerie" => "Thromb Haemost" "fecha" => "2008" "volumen" => "100" "paginaInicial" => "26" "paginaFinal" => "31" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 43 => array:3 [ "identificador" => "bib0220" "etiqueta" => "44" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Does the clinical presentation and extent of venous thrombosis predict likelihood and type of recurrence? A patient-level meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1538-7836.2010.04022.x" "Revista" => array:6 [ "tituloSerie" => "J Thromb Haemost" "fecha" => "2010" "volumen" => "8" "paginaInicial" => "2436" "paginaFinal" => "2442" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 44 => array:3 [ "identificador" => "bib0225" "etiqueta" => "45" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "D-dimer testing to determine the duration of anticoagulation therapy" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa054444" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2006" "volumen" => "355" "paginaInicial" => "1780" "paginaFinal" => "1789" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 45 => array:3 [ "identificador" => "bib0230" "etiqueta" => "46" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Residual vein obstruction to predict the risk of recurrent venous thromboembolism in patients with deep vein thrombosis: a systematic review and meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ …5] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1538-7836.2011.04254.x" "Revista" => array:6 [ "tituloSerie" => "J Thromb Haemost" "fecha" => "2011" "volumen" => "9" "paginaInicial" => "1119" "paginaFinal" => "1125" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 46 => array:3 [ "identificador" => "bib0235" "etiqueta" => "47" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Comparison of outcomes after hospitalization for deep venous thrombosis or pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ …3] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Thromb Haemost" "fecha" => "2002" "volumen" => "88" "paginaInicial" => "407" "paginaFinal" => "414" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 47 => array:3 [ "identificador" => "bib0240" "etiqueta" => "48" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Risk of recurrent venous thromboembolism in patients with common thrombophilia: a systematic review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ …4] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1001/archinte.166.7.729" "Revista" => array:6 [ "tituloSerie" => "Arch Intern Med" "fecha" => "2006" "volumen" => "166" "paginaInicial" => "729" "paginaFinal" => "736" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 48 => array:3 [ "identificador" => "bib0245" "etiqueta" => "49" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Predicting disease recurrence in patients with previous unprovoked venous thromboembolism. A proposed prediction score (DASH)" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1538-7836.2012.04735.x" "Revista" => array:6 [ "tituloSerie" => "J Thromb Haemost" "fecha" => "2012" "volumen" => "10" "paginaInicial" => "1019" "paginaFinal" => "1025" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 49 => array:3 [ "identificador" => "bib0250" "etiqueta" => "50" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Risk assessment of recurrence in patients with unprovoked deep vein thrombosis or pulmonary embolism: the Vienna prediction model" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ …4] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1161/CIRCULATIONAHA.109.925214" "Revista" => array:6 [ "tituloSerie" => "Circulation" "fecha" => "2010" "volumen" => "121" "paginaInicial" => "1630" "paginaFinal" => "1636" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 50 => array:3 [ "identificador" => "bib0255" "etiqueta" => "51" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identifying unprovoked thromboembolism patients at low risk for recurrence who can discontinue anticoagulant therapy" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Can Med Assoc J" "fecha" => "2008" "volumen" => "179" "paginaInicial" => "417" "paginaFinal" => "426" ] ] ] ] ] ] 51 => array:3 [ "identificador" => "bib0260" "etiqueta" => "52" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Comparison of low-intensity warfarin therapy with conventional-intensity warfarin therapy for long-term prevention of recurrent venous thromboembolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa035422" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2003" "volumen" => "349" "paginaInicial" => "631" "paginaFinal" => "639" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 52 => array:3 [ "identificador" => "bib0265" "etiqueta" => "53" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Long-term, low-intensity warfarin therapy for the prevention recurrent venous thromboembolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa035029" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2003" "volumen" => "348" "paginaInicial" => "1425" "paginaFinal" => "1434" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 53 => array:3 [ "identificador" => "bib0270" "etiqueta" => "54" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Apixaban for extended treatment of venous thromboembolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa1207541" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2013" "volumen" => "368" "paginaInicial" => "699" "paginaFinal" => "708" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 54 => array:3 [ "identificador" => "bib0275" "etiqueta" => "55" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Extended use of dabigatran, warfarin, or placebo in venous thromboembolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa1113697" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2013" "volumen" => "368" "paginaInicial" => "709" "paginaFinal" => "718" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 55 => array:3 [ "identificador" => "bib0280" "etiqueta" => "56" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Aspirin for preventing the recurrence of venous thromboembolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa1114238" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2012" "volumen" => "366" "paginaInicial" => "1959" "paginaFinal" => "1967" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 56 => array:3 [ "identificador" => "bib0285" "etiqueta" => "57" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Low-dose aspirin for preventing recurrent venous thromboembolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa1210384" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2012" "volumen" => "367" "paginaInicial" => "1979" "paginaFinal" => "1987" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 57 => array:3 [ "identificador" => "bib0290" "etiqueta" => "58" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Resolution of thromboemboli in patients with acute pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ …4] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1378/chest.129.1.192" "Revista" => array:6 [ "tituloSerie" => "Chest" "fecha" => "2006" "volumen" => "129" "paginaInicial" => "192" "paginaFinal" => "197" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 58 => array:3 [ "identificador" => "bib0295" "etiqueta" => "59" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The natural course of hemodynamically stable pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1378/chest.05-2799" "Revista" => array:6 [ "tituloSerie" => "Chest" "fecha" => "2007" "volumen" => "131" "paginaInicial" => "517" "paginaFinal" => "523" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 59 => array:3 [ "identificador" => "bib0300" "etiqueta" => "60" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Incidence of chronic thromboembolic pulmonary hypertension after pulmonary embolism" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1056/NEJMoa032274" "Revista" => array:6 [ "tituloSerie" => "N Engl J Med" "fecha" => "2004" "volumen" => "350" "paginaInicial" => "2257" "paginaFinal" => "2264" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] 60 => array:3 [ "identificador" => "bib0305" "etiqueta" => "61" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Chronic thromboembolic pulmonary hypertension. Risk factors" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ …3] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Arch Bronconeumol" "fecha" => "2009" "volumen" => "45" "paginaInicial" => "10" "paginaFinal" => "13" ] ] ] ] ] ] 61 => array:3 [ "identificador" => "bib0310" "etiqueta" => "62" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Is extensive screening for cancer in idiopathic venous thromboembolism warranted?" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ …6] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1538-7836.2010.04101.x" "Revista" => array:6 [ "tituloSerie" => "J Thromb Haemost" "fecha" => "2011" "volumen" => "9" "paginaInicial" => "79" "paginaFinal" => "84" "link" => array:1 [ 0 => array:2 [ …2] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001900/v1_201312010030/en/main.assets" "Apartado" => array:4 [ "identificador" => "9379" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Recommendations of SEPAR" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/15792129/0000004900000012/v1_201312010030/S1579212913001900/v1_201312010030/en/main.pdf?idApp=UINPBA00003Z&text.app=https://archbronconeumol.org/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001900?idApp=UINPBA00003Z"]

Statistics

Recommendations of SEPAR

National Consensus on the Diagnosis, Risk Stratification and Treatment of Patients with Pulmonary Embolism

Consenso nacional sobre el diagnóstico, estratificación de riesgo y tratamiento de los pacientes con tromboembolia pulmonar

Fernando Uresandia, Manuel Monrealb, Ferrán García-Bragadoc, Pere Domenechd, Ramón Lecumberrie, Pilar Escribanof, José Luis Zamoranog, Sonia Jiménezh, Pedro Ruiz-Artachoi, Francisco Lozanoj, Antonio Romerak, David Jiménezl,

Corresponding author

djc_69_98@yahoo.com

Corresponding author.

, on behalf of the National Consensus on Diagnosis, Risk Stratification and Treatment of Patients With Pulmonary Thromboembolism 1,2

a Servicio de Neumología, Hospital de Cruces, Bilbao, Spain

b Servicio de Medicina Interna, Hospital Germans Trias I Pujol, Badalona, Spain

c Servicio de Medicina Interna, Hospital Universitario de Gerona Dr. Josep Trueta, Gerona, Spain

d Servicio de Hematología, Hospital Universitario de Bellvitge, Barcelona, Spain

e Servicio de Hematología, Clínica Universitaria de Navarra, Pamplona, Spain

f Servicio de Cardiología, Hospital Doce de Octubre, Madrid, Spain

g Servicio de Cardiología, Hospital Ramón y Cajal, IRYCIS, Madrid, Spain

h Servicio de Urgencias, Hospital Clinic, Barcelona, Spain

i Servicio de Urgencias, Hospital Clínico San Carlos, Madrid, Spain

j Servicio de Angiología y Cirugía Vascular, Hospital Universitario de Bellvitge, Barcelona, Spain

k Servicio de Angiología y Cirugía Vascular, Hospital Clínico Universitario, Salamanca, Spain

l Servicio de Neumología, Hospital Ramón y Cajal, IRYCIS, Madrid, Spain

Read

16314

Times
was read the article

3709

Total PDF

12605

Total HTML

Share statistics

 array:24 [
  "pii" => "S1579212913001900"
  "issn" => "15792129"
  "doi" => "10.1016/j.arbr.2013.10.008"
  "estado" => "S300"
  "fechaPublicacion" => "2013-12-01"
  "aid" => "808"
  "copyright" => "SEPAR"
  "copyrightAnyo" => "2013"
  "documento" => "article"
  "crossmark" => 0
  "subdocumento" => "fla"
  "cita" => "Arch Bronconeumol. 2013;49:534-47"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:2 [
    "total" => 9780
    "formatos" => array:3 [
      "EPUB" => 153
      "HTML" => 7630
      "PDF" => 1997
    ]
  ]
  "Traduccion" => array:1 [
    "es" => array:19 [
      "pii" => "S0300289613002263"
      "issn" => "03002896"
      "doi" => "10.1016/j.arbres.2013.07.008"
      "estado" => "S300"
      "fechaPublicacion" => "2013-12-01"
      "aid" => "808"
      "copyright" => "SEPAR"
      "documento" => "article"
      "crossmark" => 0
      "subdocumento" => "fla"
      "cita" => "Arch Bronconeumol. 2013;49:534-47"
      "abierto" => array:3 [
        "ES" => true
        "ES2" => true
        "LATM" => true
      ]
      "gratuito" => true
      "lecturas" => array:2 [
        "total" => 138621
        "formatos" => array:3 [
          "EPUB" => 171
          "HTML" => 123289
          "PDF" => 15161
        ]
      ]
      "es" => array:11 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Normativa SEPAR</span>"
        "titulo" => "Consenso nacional sobre el diagn&#243;stico&#44; estratificaci&#243;n de riesgo y tratamiento de los pacientes con tromboembolia pulmonar"
        "tienePdf" => "es"
        "tieneTextoCompleto" => "es"
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "534"
            "paginaFinal" => "547"
          ]
        ]
        "titulosAlternativos" => array:1 [
          "en" => array:1 [
            "titulo" => "National Consensus on the Diagnosis&#44; Risk Stratification and Treatment of Patients with Pulmonary Embolism"
          ]
        ]
        "contieneTextoCompleto" => array:1 [
          "es" => true
        ]
        "contienePdf" => array:1 [
          "es" => true
        ]
        "resumenGrafico" => array:2 [
          "original" => 0
          "multimedia" => array:7 [
            "identificador" => "fig0015"
            "etiqueta" => "Figura 3"
            "tipo" => "MULTIMEDIAFIGURA"
            "mostrarFloat" => true
            "mostrarDisplay" => false
            "figura" => array:1 [
              0 => array:4 [
                "imagen" => "gr3.jpeg"
                "Alto" => 2263
                "Ancho" => 3137
                "Tamanyo" => 361981
              ]
            ]
            "descripcion" => array:1 [
              "es" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Estratificaci&#243;n pron&#243;stica y tratamiento de la tromboembolia pulmonar en fase aguda&#46; BNP&#58; p&#233;ptido natriur&#233;tico cerebral&#59; DVD&#58; disfunci&#243;n ventricular derecha&#59; Fx&#58; fondaparinux&#59; HBPM&#58; heparina de bajo peso molecular&#59; HFABP&#58; prote&#237;na ligadora de &#225;cidos grasos cardiacos&#59; HNF&#58; heparina no fraccionada&#59; hsTnT&#58; troponina T de alta sensibilidad&#59; PESI&#58; Pulmonary Embolism Severity Index&#59; PESIs&#58; PESI simplificada&#59; TVP&#58; trombosis venosa profunda&#59; UCI&#58; unidad de cuidados intensivos&#46;&#42;Shock cardiog&#233;nico o presi&#243;n arterial sist&#243;lica<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>90<span class="elsevierStyleHsp" style=""></span>mm Hg mantenida&#44; no debida a hipovolemia&#44; sepsis o arritmias cardiacas&#46;</p> <p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">La l&#237;nea discontinua indica ausencia de evidencia definitiva &#40;fibrin&#243;lisis&#41; o de experiencia cl&#237;nica amplia &#40;rivaroxaban&#41;&#46;</p> <p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Para aquellas situaciones no contempladas en el algoritmo&#44; se recomienda hospitalizaci&#243;n y tratamiento anticoagulante convencional&#46;</p>"
            ]
          ]
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "Fernando Uresandi, Manuel Monreal, Ferr&#225;n Garc&#237;a-Bragado, Pere Domenech, Ram&#243;n Lecumberri, Pilar Escribano, Jos&#233; Luis Zamorano, Sonia Jim&#233;nez, Pedro Ruiz-Artacho, Francisco Lozano, Antonio Romera, David Jim&#233;nez"
            "autores" => array:13 [
              0 => array:2 [
                "nombre" => "Fernando"
                "apellidos" => "Uresandi"
              ]
              1 => array:2 [
                "nombre" => "Manuel"
                "apellidos" => "Monreal"
              ]
              2 => array:2 [
                "nombre" => "Ferr&#225;n"
                "apellidos" => "Garc&#237;a-Bragado"
              ]
              3 => array:2 [
                "nombre" => "Pere"
                "apellidos" => "Domenech"
              ]
              4 => array:2 [
                "nombre" => "Ram&#243;n"
                "apellidos" => "Lecumberri"
              ]
              5 => array:2 [
                "nombre" => "Pilar"
                "apellidos" => "Escribano"
              ]
              6 => array:2 [
                "nombre" => "Jos&#233; Luis"
                "apellidos" => "Zamorano"
              ]
              7 => array:2 [
                "nombre" => "Sonia"
                "apellidos" => "Jim&#233;nez"
              ]
              8 => array:2 [
                "nombre" => "Pedro"
                "apellidos" => "Ruiz-Artacho"
              ]
              9 => array:2 [
                "nombre" => "Francisco"
                "apellidos" => "Lozano"
              ]
              10 => array:2 [
                "nombre" => "Antonio"
                "apellidos" => "Romera"
              ]
              11 => array:2 [
                "nombre" => "David"
                "apellidos" => "Jim&#233;nez"
              ]
              12 => array:1 [
                "colaborador" => "en representaci&#243;n del Consenso nacional sobre el diagn&#243;stico&#44; estratificaci&#243;n de riesgo y tratamiento de los pacientes con tromboembolia pulmonar"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "es"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S1579212913001900"
          "doi" => "10.1016/j.arbr.2013.10.008"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => false
            "ES2" => false
            "LATM" => false
          ]
          "gratuito" => false
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001900?idApp=UINPBA00003Z"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289613002263?idApp=UINPBA00003Z"
      "url" => "/03002896/0000004900000012/v1_201312040037/S0300289613002263/v1_201312040037/es/main.assets"
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S1579212913001924"
    "issn" => "15792129"
    "doi" => "10.1016/j.arbr.2013.10.010"
    "estado" => "S300"
    "fechaPublicacion" => "2013-12-01"
    "aid" => "784"
    "copyright" => "SEPAR"
    "documento" => "simple-article"
    "crossmark" => 0
    "subdocumento" => "crp"
    "cita" => "Arch Bronconeumol. 2013;49:548-50"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:2 [
      "total" => 4405
      "formatos" => array:3 [
        "EPUB" => 120
        "HTML" => 3201
        "PDF" => 1084
      ]
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Case report</span>"
      "titulo" => "Alpha-1-Antitrypsin Deficiency Associated With the Mattawa Variant"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "548"
          "paginaFinal" => "550"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "D&#233;ficit de alfa-1-antitripsina asociado a la variante Matawa"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Fig&#46; 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1104
              "Ancho" => 2599
              "Tamanyo" => 274980
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Sequence corresponding to exon 5 SERPINA1&#46; &#40;A&#41; Normal sequence&#46; &#40;B&#41; Sequence corresponding to the patient&#44; which shows insertion of a thymine &#40;T&#41; instead of an adenine &#40;A&#41; at codon 376 in exon 5 of heterozygosity for the PI-Mattawa allele&#46; The SERPINA1 gene coding sequence &#40;exons 2&#8211;5&#41; was analyzed using previously described primers for exons 3&#8211;5 and 5&#8242;ACGTGGTGTCAATCCCTGATCACTG3&#8242; Ex2F primers and ex2R 5&#8242;TATGGGAACAGCTGG3&#8242; for exon 2&#44; with reference to the comparative SERPINA1&#95;Transcript&#95;ENST00000440909&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Beatriz Lara, Beatriz Mart&#237;nez-Delgado, Maria Luisa Torres, Sandra Mar&#237;n-Arguedas, Ana Bustamante, Marc Miravitlles"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Beatriz"
              "apellidos" => "Lara"
            ]
            1 => array:2 [
              "nombre" => "Beatriz"
              "apellidos" => "Mart&#237;nez-Delgado"
            ]
            2 => array:2 [
              "nombre" => "Maria Luisa"
              "apellidos" => "Torres"
            ]
            3 => array:2 [
              "nombre" => "Sandra"
              "apellidos" => "Mar&#237;n-Arguedas"
            ]
            4 => array:2 [
              "nombre" => "Ana"
              "apellidos" => "Bustamante"
            ]
            5 => array:2 [
              "nombre" => "Marc"
              "apellidos" => "Miravitlles"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "es" => array:9 [
        "pii" => "S030028961300152X"
        "doi" => "10.1016/j.arbres.2013.05.004"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => true
          "ES2" => true
          "LATM" => true
        ]
        "gratuito" => true
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "es"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S030028961300152X?idApp=UINPBA00003Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001924?idApp=UINPBA00003Z"
    "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001924/v1_201312010030/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S1579212913001742"
    "issn" => "15792129"
    "doi" => "10.1016/j.arbr.2013.09.011"
    "estado" => "S300"
    "fechaPublicacion" => "2013-12-01"
    "aid" => "751"
    "copyright" => "SEPAR"
    "documento" => "article"
    "crossmark" => 0
    "subdocumento" => "fla"
    "cita" => "Arch Bronconeumol. 2013;49:529-33"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:2 [
      "total" => 5857
      "formatos" => array:3 [
        "EPUB" => 134
        "HTML" => 4259
        "PDF" => 1464
      ]
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Special Article</span>"
      "titulo" => "Comprehensive Care of Amyotrophic Lateral Sclerosis Patients&#58; A Care Model"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "529"
          "paginaFinal" => "533"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Atenci&#243;n integral a pacientes con esclerosis lateral amiotr&#243;fica&#58; un modelo asistencial"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Maria Rosa G&#252;ell, Antonio Ant&#243;n, Ricardo Rojas-Garc&#237;a, Carmen Puy, Jesus Pradas"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Maria Rosa"
              "apellidos" => "G&#252;ell"
            ]
            1 => array:2 [
              "nombre" => "Antonio"
              "apellidos" => "Ant&#243;n"
            ]
            2 => array:2 [
              "nombre" => "Ricardo"
              "apellidos" => "Rojas-Garc&#237;a"
            ]
            3 => array:2 [
              "nombre" => "Carmen"
              "apellidos" => "Puy"
            ]
            4 => array:2 [
              "nombre" => "Jesus"
              "apellidos" => "Pradas"
            ]
            5 => array:1 [
              "colaborador" => "on behalf of the entire interdisciplinary team"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "es" => array:9 [
        "pii" => "S0300289613000562"
        "doi" => "10.1016/j.arbres.2013.01.013"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => true
          "ES2" => true
          "LATM" => true
        ]
        "gratuito" => true
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "es"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289613000562?idApp=UINPBA00003Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001742?idApp=UINPBA00003Z"
    "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001742/v1_201312010030/en/main.assets"
  ]
  "en" => array:18 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Recommendations of SEPAR</span>"
    "titulo" => "National Consensus on the Diagnosis&#44; Risk Stratification and Treatment of Patients with Pulmonary Embolism"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "534"
        "paginaFinal" => "547"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Fernando Uresandi, Manuel Monreal, Ferr&#225;n Garc&#237;a-Bragado, Pere Domenech, Ram&#243;n Lecumberri, Pilar Escribano, Jos&#233; Luis Zamorano, Sonia Jim&#233;nez, Pedro Ruiz-Artacho, Francisco Lozano, Antonio Romera, David Jim&#233;nez"
        "autores" => array:13 [
          0 => array:3 [
            "nombre" => "Fernando"
            "apellidos" => "Uresandi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Manuel"
            "apellidos" => "Monreal"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Ferr&#225;n"
            "apellidos" => "Garc&#237;a-Bragado"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Pere"
            "apellidos" => "Domenech"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Ram&#243;n"
            "apellidos" => "Lecumberri"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">e</span>"
                "identificador" => "aff0025"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Pilar"
            "apellidos" => "Escribano"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">f</span>"
                "identificador" => "aff0030"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Jos&#233; Luis"
            "apellidos" => "Zamorano"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">g</span>"
                "identificador" => "aff0035"
              ]
            ]
          ]
          7 => array:3 [
            "nombre" => "Sonia"
            "apellidos" => "Jim&#233;nez"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">h</span>"
                "identificador" => "aff0040"
              ]
            ]
          ]
          8 => array:3 [
            "nombre" => "Pedro"
            "apellidos" => "Ruiz-Artacho"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">i</span>"
                "identificador" => "aff0045"
              ]
            ]
          ]
          9 => array:3 [
            "nombre" => "Francisco"
            "apellidos" => "Lozano"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">j</span>"
                "identificador" => "aff0050"
              ]
            ]
          ]
          10 => array:3 [
            "nombre" => "Antonio"
            "apellidos" => "Romera"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">k</span>"
                "identificador" => "aff0055"
              ]
            ]
          ]
          11 => array:4 [
            "nombre" => "David"
            "apellidos" => "Jim&#233;nez"
            "email" => array:1 [
              0 => "djc&#95;69&#95;98&#64;yahoo&#46;com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">l</span>"
                "identificador" => "aff0060"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">¿</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
          12 => array:2 [
            "colaborador" => "on behalf of the National Consensus on Diagnosis&#44; Risk Stratification and Treatment of Patients With Pulmonary Thromboembolism"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">1</span>"
                "identificador" => "fn1"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">2</span>"
                "identificador" => "fn2"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:12 [
          0 => array:3 [
            "entidad" => "Servicio de Neumolog&#237;a&#44; Hospital de Cruces&#44; Bilbao&#44; Spain"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Servicio de Medicina Interna&#44; Hospital Germans Trias I Pujol&#44; Badalona&#44; Spain"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Servicio de Medicina Interna&#44; Hospital Universitario de Gerona Dr&#46; Josep Trueta&#44; Gerona&#44; Spain"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Servicio de Hematolog&#237;a&#44; Hospital Universitario de Bellvitge&#44; Barcelona&#44; Spain"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
          4 => array:3 [
            "entidad" => "Servicio de Hematolog&#237;a&#44; Cl&#237;nica Universitaria de Navarra&#44; Pamplona&#44; Spain"
            "etiqueta" => "e"
            "identificador" => "aff0025"
          ]
          5 => array:3 [
            "entidad" => "Servicio de Cardiolog&#237;a&#44; Hospital Doce de Octubre&#44; Madrid&#44; Spain"
            "etiqueta" => "f"
            "identificador" => "aff0030"
          ]
          6 => array:3 [
            "entidad" => "Servicio de Cardiolog&#237;a&#44; Hospital Ram&#243;n y Cajal&#44; IRYCIS&#44; Madrid&#44; Spain"
            "etiqueta" => "g"
            "identificador" => "aff0035"
          ]
          7 => array:3 [
            "entidad" => "Servicio de Urgencias&#44; Hospital Clinic&#44; Barcelona&#44; Spain"
            "etiqueta" => "h"
            "identificador" => "aff0040"
          ]
          8 => array:3 [
            "entidad" => "Servicio de Urgencias&#44; Hospital Cl&#237;nico San Carlos&#44; Madrid&#44; Spain"
            "etiqueta" => "i"
            "identificador" => "aff0045"
          ]
          9 => array:3 [
            "entidad" => "Servicio de Angiolog&#237;a y Cirug&#237;a Vascular&#44; Hospital Universitario de Bellvitge&#44; Barcelona&#44; Spain"
            "etiqueta" => "j"
            "identificador" => "aff0050"
          ]
          10 => array:3 [
            "entidad" => "Servicio de Angiolog&#237;a y Cirug&#237;a Vascular&#44; Hospital Cl&#237;nico Universitario&#44; Salamanca&#44; Spain"
            "etiqueta" => "k"
            "identificador" => "aff0055"
          ]
          11 => array:3 [
            "entidad" => "Servicio de Neumolog&#237;a&#44; Hospital Ram&#243;n y Cajal&#44; IRYCIS&#44; Madrid&#44; Spain"
            "etiqueta" => "l"
            "identificador" => "aff0060"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Consenso nacional sobre el diagn&#243;stico&#44; estratificaci&#243;n de riesgo y tratamiento de los pacientes con tromboembolia pulmonar"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 4041
            "Ancho" => 2253
            "Tamanyo" => 312359
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Diagnostic algorithm for the hemodynamically stable outpatient&#46; &#40;A&#41; Angio-CT&#44; computed tomography angiography&#46; <span class="elsevierStyleSup">1</span>Refers to high sensitivity D-dimer&#46; In the case of less sensitive D-dimer&#44; PE can only be ruled out in patients with low clinical probability or PE unlikely&#46; <span class="elsevierStyleSup">2</span>In case of high clinical probability and negative multidetector angio-CT&#44; additional diagnostic tests are suggested &#40;V&#47;Q scan and&#47;or Doppler ultrasound of lower extremities&#41;&#46; &#40;B&#41; DVT&#44; deep vein thrombosis&#46; <span class="elsevierStyleSup">1</span>Refers to low or intermediate probability V&#47;Q scans&#46; <span class="elsevierStyleSup">2</span>In case of high clinical probability&#44; inconclusive perfusion scan&#44; and negative ultrasound of lower extremities&#44; the need for multidetector angio-CT should be assessed with the appropriate specialist&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0005">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Pulmonary embolism &#40;PE&#41; is a public health problem of the first order&#46; Although less common than other vascular diseases&#44; such as myocardial infarction or cerebrovascular disease&#44; PE is equally as serious&#46; The Spanish Medical Societies involved in the care of these patients have drawn up a consensus document that aims to update the recommendations for the diagnosis&#44; prognosis and treatment of this disease using the best available evidence&#46; This consensus document makes <span class="elsevierStyleItalic">recommendations</span> or <span class="elsevierStyleItalic">suggestions</span> based on the interpretation of the available evidence and its quality&#44; risk-benefit balance of the interventions&#44; and the cost&#46; This was based on two documents&#58; Antithrombotic Therapy and Prevention of Thrombosis&#44; 9th ed&#46;&#58; American College of Chest Physicians &#40;ACCP&#41;&#46; Evidence-Based Clinical Practice Guidelines<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> and the National Institute for Health and Clinical Excellence &#40;NICE&#41; clinical guidelines on venous thromboembolic &#40;VTE&#41; diseases&#46;<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a> Both documents use the GRADE system<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">3</span></a> to establish recommendations&#46; A systematic review of the literature published between January 2012 and March 2013 was also performed&#46; Based on these documents and the systematic literature review&#44; two authors &#40;FU and DJ&#41; prepared a manuscript that formed the basis for the final discussion &#40;in a face-to-face meeting&#41; by a panel composed of the coordinators of each of the participating Scientific Societies&#46; All the recommendations or suggestions were agreed between the attendees at this session&#46; Consensus was reached by discussion between the panel members&#44; considering the potential risks and benefits of the interventions&#44; routine clinical practice&#44; recommendations of other guidelines&#44; patient preference&#44; and equity criteria&#46; The authors of the document also took into account clinical situations in which a lack of evidence justifies waiting until research results become available in the future&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Concept&#44; Pathogenesis&#44; Risk Factors and Epidemiology</span><p id="par0010" class="elsevierStylePara elsevierViewall">PE occurs when a detached thrombus &#40;embolism&#41; from any part of the venous territory becomes lodged in the pulmonary arteries&#46; Although the origin of the embolism may be venous thrombosis in any location &#40;upper extremities&#44; prostatic&#44; uterine and renal veins and right heart chambers&#41;&#44; in most cases &#40;90&#37;&#8211;95&#37;&#41; it is a lower extremity &#40;LE&#41; deep vein thrombosis &#40;DVT&#41;&#44; often asymptomatic&#46;</p><p id="par0015" class="elsevierStylePara elsevierViewall">The risk factors &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41; for developing PE are related with one or several of the etiopathogenic mechanisms of the disease&#58; stasis&#44; endothelial lesion and hypercoagulability&#46; These guidelines classify them as major or minor&#44; depending on whether their prothrombotic risk is high or moderate-low&#44; respectively&#46; When the VTE is associated with precipitating risk factors&#44; it is classified as <span class="elsevierStyleItalic">provoked</span> or <span class="elsevierStyleItalic">secondary</span>&#46; When there are no precipitating factors&#44; it is known as <span class="elsevierStyleItalic">unprovoked</span>&#44; <span class="elsevierStyleItalic">spontaneous</span> or <span class="elsevierStyleItalic">idiopathic</span>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0020" class="elsevierStylePara elsevierViewall">There is an estimated incidence of PE of 1 case per 1000 population per year&#44; although the real incidence is likely to be higher&#46; According to data from the Spanish Ministry for Health&#44; 22 250 cases of PE were diagnosed in 2010&#44; with an in-hospital mortality of 8&#46;9&#37;&#46;</p></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Diagnosis</span><p id="par0025" class="elsevierStylePara elsevierViewall">No single test is sensitive and specific enough to confirm or rule out acute symptomatic PE&#46; The diagnosis of the disease must therefore be combined with clinical suspicion&#44; D-dimer results and imaging tests&#46; Following widely accepted diagnostic algorithms improves the prognosis in patients assessed for suspected PE&#46;<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a> A diagnostic algorithm has been proposed for hemodynamically stable patients with suspected PE &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>A and B&#41; and another for unstable patients &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#41;&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia><p id="par0030" class="elsevierStylePara elsevierViewall">The diagnostic process does not justify delays in initiating anticoagulant treatment&#44; which should be administered early in patients with intermediate or high clinical suspicion&#46;<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">&#8226;</span><p id="par0035" class="elsevierStylePara elsevierViewall">It is recommended to start anticoagulant treatment early &#40;before the results of diagnostic tests become available&#41; in patients with an intermediate or high probability of PE&#46;</p></li></ul></p><span id="sec0225" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Clinical Suspicion</span><p id="par0040" class="elsevierStylePara elsevierViewall">The diagnosis of acute symptomatic PE should be considered in all patients who report new onset dyspnea&#44; worsening of their usual dyspnea&#44; chest pain&#44; syncope or hypotension with no alternative explanation&#44; particularly when the basic complementary tests &#40;chest X-ray&#44; electrocardiogram and arterial blood gases&#41; rule out other differential diagnoses&#46; <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a> lists some of the usual radiological and electrocardiographic findings in PE&#46; Standardized testing using clinical prediction rules classifies patients into categories with different PE prevalence &#40;approximately 10&#37; for low probability&#44; 25&#37; for intermediate probability and &#62;60&#37; for high probability&#41; and facilitates the interpretation of other diagnostic tests&#46; The Wells and Geneva scores &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41; have been the most extensively validated&#46;<ul class="elsevierStyleList" id="lis0010"><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0045" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">The use of adequately validated clinical scales &#40;Wells or Geneva&#41; is recommended as a first step in the diagnostic approach to the hemodynamically stable patient with suspected PE&#46;</span></p></li></ul></p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><elsevierMultimedia ident="tbl0015"></elsevierMultimedia></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">D-Dimer</span><p id="par0050" class="elsevierStylePara elsevierViewall">D-dimer is a fibrin degradation product present in the thrombus&#44; generated when the clot undergoes proteolysis by plasmin&#46; It is a highly sensitive test&#44; but has low specificity&#44; because the finding of high levels may also be associated with other clinical situations such as advanced age&#44; infection&#44; cancer&#44; pregnancy or hospital admission&#46;</p><p id="par0055" class="elsevierStylePara elsevierViewall">In normotensive patients with a low or intermediate probability of PE&#44; a negative high sensitivity &#40;&#8805;95&#37;&#41; D-dimer &#40;&#60;500<span class="elsevierStyleHsp" style=""></span>ng&#47;ml&#41; excludes the diagnosis of PE&#46; In patients who do not receive anticoagulant therapy&#44; the incidence of VTE in the following 3 months is 0&#46;14&#37; &#40;95&#37; confidence interval &#91;CI&#93;&#44; 0&#46;05&#8211;0&#46;41&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">5</span></a> Low or moderate sensitivity methods for determination of D-dimer &#40;&#60;95&#37;&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>&#41; only exclude the disease in the group of patients with low clinical probability &#40;or with PE unlikely according to the dichotomized Wells score&#41;&#46;<ul class="elsevierStyleList" id="lis0015"><li class="elsevierStyleListItem" id="lsti0015"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0060" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">It is recommended that the sensitivity of the D-dimer method used in each setting is known&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0020"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0065" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">A negative high sensitivity D-dimer excludes PE in patients with low or intermediate clinical probability&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0025"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0070" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">A negative moderate or low sensitivity D-dimer excludes PE in patients with low clinical probability &#40;or PE unlikely&#41;&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0030"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0075" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">It is recommended not to measure D-dimer in patients with a high probability of PE&#46;</span></p></li></ul></p><elsevierMultimedia ident="tbl0020"></elsevierMultimedia></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Imaging Tests</span><p id="par0080" class="elsevierStylePara elsevierViewall">The most commonly used imaging tests are multidetector chest computed tomography angiography &#40;angio-CT&#41;&#44; ventilation&#47;perfusion &#40;V&#47;Q&#41; lung scan and venous ultrasound of the LE&#44; with or without Doppler &#40;DU&#41;&#46;</p><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Multidetector Computed Tomography Angiography</span><p id="par0085" class="elsevierStylePara elsevierViewall">Multidetector angio-CT is currently the imaging test of choice for the diagnosis of PE&#46; In a systematic review and meta-analysis<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> that included 2020 patients from 3 studies&#44; the thromboembolic risk in patients who did not receive anticoagulant treatment based on a negative angio-CT was 1&#46;2&#37; &#40;95&#37; CI&#44; 0&#46;8&#8211;1&#46;8&#41;&#44; with a risk of fatal PE of 0&#46;6&#37;&#46;</p><p id="par0090" class="elsevierStylePara elsevierViewall">PIOPED II<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">7</span></a> was a multicenter study that evaluated the diagnostic usefulness of 4&#44; 8 or 16 detector angio-CT in patients with suspected PE&#46; The overall sensitivity was 83&#37; &#40;95&#37; CI&#44; 76&#8211;92&#41; and the specificity was 96&#37; &#40;95&#37; CI&#44; 93&#8211;97&#41;&#46; In this study&#44; the negative predictive value &#40;NPV&#41; of multidetector angio-CT increased marginally when venography was added in the same examination&#46; It should be noted that the NPV of multidetector angio-CT was only 60&#37; in patients with a high clinical probability of PE&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">Multidetector angio-CT provides an effective dose of radiation of 7<span class="elsevierStyleHsp" style=""></span>milliSievert&#44; equivalent to 2 years of natural background radiation&#44; which translates into a low additional lifetime risk of fatal cancer&#46;<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a> Existing equipment enables the test to be performed with a reduced radiation dose&#46; Nevertheless&#44; the indication in fertile women must be justified in terms of the risk-benefit balance&#46; In pregnant women&#44; it is advisable to perform a perfusion scan before multidetector angio-CT&#44; due to the lower radiation&#44; provided that the chest X-ray is normal&#46;<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a> If multidetector angio-CT is done&#44; breast protection is recommended&#46; It is not known if it has any effect on breast milk during breastfeeding&#46; In patients with renal failure&#44; angio-CT may be performed following local protocols for prevention of contrast-induced nephropathy&#46;<ul class="elsevierStyleList" id="lis0020"><li class="elsevierStyleListItem" id="lsti0035"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0100" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">A negative multidetector angio-CT &#40;technically adequate&#41; rules out PE&#44; except in patients with a high clinical probability of the disease&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0040"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0105" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">It is recommended that additional diagnostic tests be carried out in patients with suspected PE and inconclusive multidetector angio-CT&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0045"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0110" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">It is suggested that additional diagnostic tests be carried out in patients with a high suspicion of PE and negative multidetector angio-CT&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0050"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0115" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">It is recommended not to perform CT venography routinely to increase the diagnostic yield of multidetector angio-CT&#46;</span></p></li></ul></p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Lung Scintigraphy</span><p id="par0120" class="elsevierStylePara elsevierViewall">The V&#47;Q scan has been replaced by multidetector angio-CT as the diagnostic test of choice&#46; At present&#44; it is generally reserved for patients with iodinated contrast allergy&#44; some cases with renal failure or for pregnant women with suspected PE in which the DU of the LE was negative&#44; providing that the chest x-ray was normal&#46;</p><p id="par0125" class="elsevierStylePara elsevierViewall">In the PIOPED I study&#44;<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a> the NPV of a normal scan was 97&#37; and the positive predictive value &#40;PPV&#41; of a high-probability scan was 85&#37;&#8211;90&#37;&#46; However&#44; the scan was diagnostic &#40;normal or high probability&#41; in only 30&#37;&#8211;50&#37; of patients&#46; In the remaining patients&#44; the V&#47;Q scan was inconclusive &#40;low&#44; intermediate or indeterminate probability&#41;&#46;<ul class="elsevierStyleList" id="lis0025"><li class="elsevierStyleListItem" id="lsti0055"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0130" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">A normal V&#47;Q scan rules out clinically significant PE&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0060"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0135" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">A high-probability V&#47;Q scan confirms PE in patients with an intermediate or high probability of the disease&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0065"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0140" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">It is recommended that additional diagnostic tests be carried out in patients with suspected PE and inconclusive V&#47;Q scan&#46;</span></p></li></ul></p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Lower Extremity Venous Ultrasound</span><p id="par0145" class="elsevierStylePara elsevierViewall">DU is the method of choice for the detection of concomitant DVT in patients with PE&#46; The main diagnostic criterion is lack of compressibility of the venous lumen&#46; It is particularly sensitive and specific in patients with DVT symptoms and in the femoropopliteal territory&#44; but its yield decreases when the DVT is asymptomatic or located in the sural territory&#46; Approximately 50&#37; of patients with acute symptomatic PE have concomitant DVT at the time of diagnosis&#44; only half of whom are symptomatic&#46; It is presently reserved for use in patients with discrepancy between the clinical probability and the result of the thoracic imaging tests&#44; for patients with inconclusive thoracic tests&#44; and for pregnant patients as a first examination in the diagnostic algorithm&#46;<ul class="elsevierStyleList" id="lis0030"><li class="elsevierStyleListItem" id="lsti0070"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0150" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">DU is recommended as a first examination in pregnant patients with suspected PE&#46;</span></p></li></ul></p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Pulmonary Magnetic Resonance Angiography</span><p id="par0155" class="elsevierStylePara elsevierViewall">A priori&#44; this test does not differ from multidetector angio-CT in obtaining images of the pulmonary arterial tree&#46; It has the advantage that it uses gadolinium &#40;which does not contain iodine&#41; as a contrast and does not radiate patients&#46; In the PIOPED III study&#44; its sensitivity was 78&#37; and specificity was 99&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0055"><span class="elsevierStyleSup">11</span></a> On extending the study with magnetic resonance venography&#44; the sensitivity increased to 92&#37; with a specificity of 96&#37;&#46; The examination was technically inadequate in 25&#37; of patients&#44; which is its major limitation&#46; It may be reserved for patients with iodinated contrast allergy&#46; In the case of severe renal failure &#40;creatinine clearance &#60;30<span class="elsevierStyleHsp" style=""></span>ml&#47;min&#41;&#44; it is contraindicated due to the toxicity of gadolinium&#46; It should be avoided in pregnancy and breastfeeding&#44; although there is no clear evidence of teratogenic effects&#46;<ul class="elsevierStyleList" id="lis0035"><li class="elsevierStyleListItem" id="lsti0075"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0160" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">It is recommended not to perform pulmonary magnetic resonance angiography routinely for the diagnosis of patients with suspected PE&#46;</span></p></li></ul></p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Transthoracic Echocardiography</span><p id="par0165" class="elsevierStylePara elsevierViewall">In general&#44; transthoracic echocardiography is not useful in the diagnostic algorithm of patients with suspected PE&#46; Although multidetector angio-CT is also the diagnostic test of choice in hemodynamically unstable patients with suspected PE&#44; bedside echocardiography may provide very valuable diagnostic information in centers in which multidetector angio-CT is not available&#44; or in cases in which the patient&#39;s instability prevents their transfer to the radiology department&#46; In critically ill patients&#44; the absence of echocardiography signs of right-sided heart dysfunction or overload rules out PE as a cause of hemodynamic compromise&#46;<ul class="elsevierStyleList" id="lis0040"><li class="elsevierStyleListItem" id="lsti0080"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0170" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">It is recommended not to perform transthoracic echocardiography routinely for the diagnosis of stable patients with suspected PE&#46;</span></p></li></ul></p></span></span></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Prognostic Stratification of Patients With Pulmonary Embolism</span><p id="par0175" class="elsevierStylePara elsevierViewall">PE is a disease with a wide spectrum of clinical manifestations&#44; with different prognoses and treatment&#46; The most important prognostic factor is the patient&#39;s hemodynamic status at the time of diagnosis&#46;<a class="elsevierStyleCrossRef" href="#bib0060"><span class="elsevierStyleSup">12</span></a><span class="elsevierStyleItalic">High-risk</span> PE &#40;previously known as massive PE&#41;&#44; which is characterized by hypotension or shock&#44; accounts for around 5&#37; of cases and is associated with early mortality in at least 15&#37;&#46; Thrombolytic treatment is usually recommended for these patients&#46;</p><p id="par0180" class="elsevierStylePara elsevierViewall">However&#44; most patients with PE present with few symptoms&#46; Early mortality in hemodynamically stable patients diagnosed with PE varies between 2&#37; and 10&#37;&#46; Risk stratification of normotensive patients with PE should be used to identify a subgroup of patients with a <span class="elsevierStyleItalic">low risk</span> of all-cause mortality&#44; who may benefit from early discharge or even outpatient treatment of their disease&#44; and a subgroup of patients with a higher risk of complications associated with the PE itself &#40;<span class="elsevierStyleItalic">intermediate-risk</span> PE&#44; previously sub-massive PE&#41;&#44; who may benefit from aggressive treatments for their disease &#40;intensive monitoring&#44; fibrinolysis&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0065"><span class="elsevierStyleSup">13</span></a></p><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Prognostic Factors</span><p id="par0185" class="elsevierStylePara elsevierViewall">The most commonly used prognostic factors in normotensive patients with PE are summarized in <a class="elsevierStyleCrossRef" href="#tbl0025">Table 5</a>&#46; In general&#44; these tools assess the patient&#39;s clinical condition and general health status&#44; right ventricular dysfunction&#44; the thrombotic burden and myocardial damage&#46;</p><elsevierMultimedia ident="tbl0025"></elsevierMultimedia></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Identification of Patients With Low-Risk Pulmonary Embolism</span><p id="par0190" class="elsevierStylePara elsevierViewall">The most useful tools for classifying low risk patients with acute symptomatic PE are the prognostic clinical scores&#46; The combination of a set of variables that takes into account the age&#44; comorbidity and cardiovascular repercussion of PE reliably identifies a subgroup of patients &#40;approximately 30&#37;&#41; with a less than 2&#37; risk of early mortality&#46; The Pulmonary Embolism Severity Index &#40;PESI&#41; and simplified PESI &#40;sPESI&#41; clinical scores &#40;<a class="elsevierStyleCrossRef" href="#tbl0030">Table 6</a>&#41; have been extensively validated as excellent tools for the identification of these low risk patients&#46;<a class="elsevierStyleCrossRefs" href="#bib0070"><span class="elsevierStyleSup">14&#44;15</span></a> The sPESI score is easier to use than the original&#44; while retaining its prognostic ability&#46;</p><elsevierMultimedia ident="tbl0030"></elsevierMultimedia><p id="par0195" class="elsevierStylePara elsevierViewall">The value of combining the clinical scores and some biochemical markers &#40;particularly brain natriuretic peptide &#91;BNP&#93; or high sensitivity troponin &#91;hsTnT&#93;&#41; or imaging tests &#40;transthoracic echocardiogram or DU&#41; for the identification of this group of low risk patients has not been completely clarified&#46;<ul class="elsevierStyleList" id="lis0045"><li class="elsevierStyleListItem" id="lsti0085"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0200" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">It is recommended to use well validated prognostic clinical scores &#40;PESI or simplified PESI&#41; as a first step for the identification of patients with low-risk PE&#46;</span></p></li></ul></p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Identification of Patients With Intermediate-Risk Pulmonary Embolism</span><p id="par0205" class="elsevierStylePara elsevierViewall">The most widely used method in clinical practice for evaluating right ventricular function is transthoracic echocardiography&#46; Various quantitative parameters &#40;right ventricular end-diastolic diameter in the parasternal long axis view&#44; ventricular end-diastolic diameter ratio in the apical 4C projection&#44; tricuspid regurgitation peak velocity&#44; diameter of the inferior vena cava&#44; pulmonary artery acceleration time or TAPSE &#91;Tricuspid Annular Plane Systolic Excursion&#93;&#41; have been used to estimate the degree of ventricular dysfunction&#46; Its use for the identification of patients with intermediate-risk PE is limited by its operator-dependence&#44; cost and lack of continuous availability in many centers&#46; Furthermore&#44; there is no echocardiographic pattern of right ventricular dysfunction that is sufficiently reliable as to justify&#44; on its own&#44; the use of fibrinolytic treatment&#46;<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a></p><p id="par0210" class="elsevierStylePara elsevierViewall">The images generated by angio-CT not only enable the diagnosis of PE to be confirmed or discarded&#44; but they can also assess the extension of the arterial obstruction and the presence or not of right ventricular dilatation&#46;<a class="elsevierStyleCrossRefs" href="#bib0085"><span class="elsevierStyleSup">17&#44;18</span></a> Although ventricular size volumetric reconstruction studies may offer a more accurate prognostic assessment&#44; more recent studies use the ratio between the ventricular diameters as a parameter of ventricular dysfunction &#40;with different cut-off points&#41;&#46; Its isolated use for identifying patients with intermediate-risk PE who could benefit from fibrinolytic treatment is not recommended&#46;</p><p id="par0215" class="elsevierStylePara elsevierViewall">Various meta-analyses have demonstrated the prognostic value of myocardial ischemia &#40;identified by elevated troponin I or T levels&#41; in hemodynamically stable patients with PE&#44; although the power of the association is not sufficiently robust as to justify therapeutic escalation&#46;<a class="elsevierStyleCrossRefs" href="#bib0095"><span class="elsevierStyleSup">19&#44;20</span></a> Cardiomyocyte stress causes release of natriuretic peptides into the circulation &#40;BNP and NT-pro-BNP&#41;&#46;<a class="elsevierStyleCrossRefs" href="#bib0105"><span class="elsevierStyleSup">21&#44;22</span></a> Several studies and meta-analyses suggest that they are useful for identifying patients with intermediate-risk PE&#46; However&#44; the sensitivity of these cardiac biomarkers for death due to PE is insufficient to establish the indication for thrombolytic treatment&#46;</p><p id="par0220" class="elsevierStylePara elsevierViewall">An association has been shown between the persistence of thrombotic material in the lower extremity deep vein system and short- and mid-term mortality of patients with PE&#46;<a class="elsevierStyleCrossRef" href="#bib0115"><span class="elsevierStyleSup">23</span></a> The presence of concomitant DVT&#44; together with other imaging tests and cardiac biomarkers&#44; may serve to identify a patient profile with a particularly high risk of complications associated with the PE itself&#46;<ul class="elsevierStyleList" id="lis0050"><li class="elsevierStyleListItem" id="lsti0090"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0225" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">A combination of prognostic tests &#40;which identify right ventricular dysfunction&#44; myocardial ischemia&#44; cardiomyocyte stress or thrombotic burden&#41; is suggested for identifying patients with intermediate risk PE&#46;</span></p></li></ul></p></span></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Treatment of Pulmonary Embolism in the Initial Phase &#40;Acute Phase And up to 3&#8211;6 Months&#41;</span><p id="par0230" class="elsevierStylePara elsevierViewall">The initial treatment of PE is aimed at medical stabilization of the patient and symptom relief&#44; resolution of the vascular obstruction and prevention of recurrence&#46; The priority in achieving these objectives depends on the severity of the patient&#46; On most occasions&#44; all the objectives are reached with conventional anticoagulant treatment&#44; which prevents progression of the clot while the endogenous fibrinolytic system resolves the vascular obstruction and collateral circulation develops&#46; A minority of patients&#44; usually those with hemodynamic instability &#40;high-risk PE&#41; or contraindication for anticoagulation&#44; require other pharmacological treatments &#40;thrombolytics&#41; or mechanical measures &#40;vena caval filters&#41; to accelerate lysis of the clot or prevent its embolization to the lungs<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>&#41;&#46; <a class="elsevierStyleCrossRef" href="#tbl0035">Table 7</a> lists the administration guidelines for drugs approved for treatment of the acute phase of PE&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia><elsevierMultimedia ident="tbl0035"></elsevierMultimedia><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Anticoagulation With Unfractionated Heparin&#44; Low Molecular Weight Heparins or Fondaparinux</span><p id="par0235" class="elsevierStylePara elsevierViewall">For decades&#44; unfractionated heparin &#40;UFH&#41; has been the drug of choice for the treatment of PE&#46; It exerts its anticoagulant action by binding to antithrombin and potentiating its effect in the inactivation of a series of activated coagulation factors&#44; mainly thrombin &#40;IIa&#41;&#46; It is usually administered intravenously &#40;iv&#41; as a continuous infusion&#44; but it is also safe and effective using the subcutaneous route &#40;sc&#41;&#46; It requires monitoring using the activated partial thromboplastin time &#40;APTT&#41;&#44; which should be 1&#46;5&#8211;2&#46;5 times the control value&#44; so an initial infusion rate of 18<span class="elsevierStyleHsp" style=""></span>U&#47;kg&#47;h is used&#46; As well as continuous infusion&#44; an 80<span class="elsevierStyleHsp" style=""></span>U&#47;kg bolus is usually administered to achieve a more rapid anticoagulant effect&#46; Patients who are treated with lower doses and who do not reach a therapeutic APTT in the first few days of treatment have an increased risk of recurrent VTE&#46; It is not known if there is a relationship between sub-therapeutic APTT levels and recurrence in patients who are treated initially with the recommended doses&#46; UFH is currently reserved for patients in whom the use of fibrinolytic treatment is considered &#40;intermediate- or high-risk PE&#41;&#44; and for patients at a high risk of bleeding who are to receive anticoagulant therapy&#46; For patients with severe renal failure &#40;creatinine clearance &#60;30<span class="elsevierStyleHsp" style=""></span>ml&#47;min&#41;&#44; some indirect evidence suggests that low molecular weight heparins &#40;LMWH&#41; &#40;at the doses recommended in the Summary of Product Characteristics&#41; could be safer and more effective than UFH&#46;<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">24</span></a></p><p id="par0240" class="elsevierStylePara elsevierViewall">LMWH are prepared from the fractionation of UFH by chemical or enzymatic methods&#46; They have potent antiXa action &#40;greater than that of UFH&#41;&#46; Most studies suggest that LMWH and UFH are equivalent in terms of efficacy &#40;recurrent VTE&#41; and safety &#40;major bleeding&#41; for treatment of the acute phase of VTE&#46; In a meta-analysis that included 1951 patients from 12 studies comparing LMWH with UFH&#44; LMWH were associated with fewer recurrent VTE &#40;odds ratio &#91;OR&#93; 0&#46;63&#59; 95&#37; CI&#44; 0&#46;33&#8211;1&#46;18&#41; and fewer major bleeding events &#40;OR 0&#46;67&#59; 95&#37; CI&#44; 0&#46;36&#8211;1&#46;27&#41;&#44; with no differences in mortality &#40;OR 1&#46;20&#59; 95&#37; CI&#44; 0&#46;59&#8211;2&#46;45&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0125"><span class="elsevierStyleSup">25</span></a></p><p id="par0245" class="elsevierStylePara elsevierViewall">Fondaparinux is a synthetic pentasaccharide that selectively inhibits factor Xa without inactivating thrombin&#46; It is administered subcutaneously once daily at weight-adjusted doses and does not require monitoring&#46; The Matisse investigators evaluated its efficacy and safety in the treatment of acute DVT and PE&#46;<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">26</span></a> Compared with UFH&#44; they did not observe any differences in the rate of recurrent thromboembolic events &#40;1&#46;3&#37; vs 1&#46;7&#37; in the acute phase&#41;&#44; major bleeds &#40;1&#46;3&#37; vs 1&#46;1&#37;&#41; or mortality in the first 3 months of follow-up&#46; A potential advantage of this drug is that it is not associated with heparin-induced thrombocytopenia &#40;HIT&#41;&#46;<ul class="elsevierStyleList" id="lis0055"><li class="elsevierStyleListItem" id="lsti0095"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0250" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">The use of LMWH or fondaparinux instead of UFH is suggested in hemodynamically stable patients with acute PE&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0100"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0255" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">The use of LMWH at doses adjusted to the UFH is suggested in patients with acute PE and severe renal failure&#46;</span></p></li></ul></p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Beginning Oral Anticoagulation</span><p id="par0260" class="elsevierStylePara elsevierViewall">Studies demonstrating that heparin treatment for 5 days instead of 10 is a safe&#44; effective practice also showed that oral anticoagulants could be started on the first day of anticoagulation&#44; without losing efficacy&#46; Two clinical trials with warfarin have shown that&#58; &#40;1&#41; loading doses &#40;which may cause hemorrhages&#41; should be avoided without this incurring a delay in reaching therapeutic INR levels&#59; &#40;2&#41; commencing vitamin K antagonists &#40;VKA&#41; at lower doses avoids excessive falls in protein C levels&#44; which would theoretically induce a state of hypercoagulability&#46;<ul class="elsevierStyleList" id="lis0060"><li class="elsevierStyleListItem" id="lsti0105"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0265" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">In hemodynamically stable patients with PE&#44; it is recommended that parenteral anticoagulation be maintained for at least 5 days&#44; and until the INR is &#62;2&#46;0 for 24<span class="elsevierStyleHsp" style=""></span>h&#46;</span></p></li></ul></p></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">New Oral Anticoagulants</span><p id="par0270" class="elsevierStylePara elsevierViewall">New oral anticoagulants have recently been introduced that act differently to the VKA&#44; among which are dabigatran &#40;direct thrombin inhibitor&#41;&#44; rivaroxaban and apixaban &#40;factor Xa inhibitors&#41;&#46; Rivaroxaban is a direct selective factor Xa inhibitor&#46; In the joint analysis of two clinical trials &#40;for DVT and PE&#41;&#44; rivaroxaban was associated with an efficacy similar to that of standard treatment &#40;hazard ratio &#91;HR&#93; 0&#46;87&#59; 95&#37; CI&#44; 0&#46;66&#8211;1&#46;19&#41; while major bleeding was reduced to half &#40;HR 0&#46;54&#44; 95&#37; CI&#44; 0&#46;37&#8211;0&#46;79&#41;&#46;<a class="elsevierStyleCrossRefs" href="#bib0135"><span class="elsevierStyleSup">27&#44;28</span></a> Its oral administration&#44; at a dose of 15<span class="elsevierStyleHsp" style=""></span>mg twice daily for 3 weeks followed by 20<span class="elsevierStyleHsp" style=""></span>mg once daily&#44; could provide a simple&#44; single-drug approach to the acute and long-term treatment of PE&#46;</p><p id="par0275" class="elsevierStylePara elsevierViewall">Apixaban has been evaluated in a clinical trial for the treatment of patients with DVT or PE &#40;34&#37;&#41; for the first 6 months after a thrombotic event&#46;<a class="elsevierStyleCrossRef" href="#bib0145"><span class="elsevierStyleSup">29</span></a> Compared with standard treatment&#44; apixaban showed similar efficacy &#40;relative risk &#91;RR&#93; 0&#46;84&#59; 95&#37; CI&#44; 0&#46;60&#8211;1&#46;18&#41; and a statistically significant reduction in major bleeding &#40;RR 0&#46;31&#59; IC 95&#37;&#44; 0&#46;17&#8211;0&#46;55&#41; and clinically relevant non-major bleeding &#40;RR 0&#46;48&#59; 95&#37; CI&#44; 0&#46;38&#8211;0&#46;60&#41;&#46; It was administered orally&#44; at a dose of 10<span class="elsevierStyleHsp" style=""></span>mg twice daily for the first 7 days followed by 5<span class="elsevierStyleHsp" style=""></span>mg twice daily&#46;</p><p id="par0280" class="elsevierStylePara elsevierViewall">The efficacy and safety of dabigatran has not been evaluated during the first 10 days &#40;on average&#41; of treatment of acute symptomatic PE&#46;<ul class="elsevierStyleList" id="lis0065"><li class="elsevierStyleListItem" id="lsti0110"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0285" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Treatment with rivaroxaban as monotherapy is suggested in hemodynamically stable patients with PE&#46;</span></p></li></ul></p></span><span id="sec0100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Early vs Standard Discharge in Pulmonary Embolism Patients</span><p id="par0290" class="elsevierStylePara elsevierViewall">The results of a clinical trial and some cohort studies suggest that&#44; compared with hospitalization&#44; outpatient treatment in low risk patients is equally effective and safe in terms of recurrent VTE&#44; bleeding events and mortality&#46;<a class="elsevierStyleCrossRef" href="#bib0150"><span class="elsevierStyleSup">30</span></a> Outpatient treatment can be considered in patients with PE who meet the following requirements&#58; &#40;1&#41; clinically stable with good cardiopulmonary reserve&#44; and a low risk validated clinical score &#40;e&#46;g&#46; PESI or sPESI&#41;&#44; &#40;2&#41; good social support with rapid access to medical care and &#40;3&#41; expected treatment compliance&#46;<ul class="elsevierStyleList" id="lis0070"><li class="elsevierStyleListItem" id="lsti0115"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0295" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">In patients with low-risk PE and adequate home conditions&#44; early discharge is suggested instead of standard discharge &#40;more than 5 days admission&#41;&#46;</span></p></li></ul></p></span><span id="sec0105" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Early Mobilization vs Rest in Acute Pulmonary Embolism</span><p id="par0300" class="elsevierStylePara elsevierViewall">Several meta-analyses have shown that early mobilization is a safe practice in patients with proximal DVT&#46;<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">31</span></a> The evidence is less consistent for patients with symptomatic PE&#46; The presence of concomitant DVT worsens the prognosis in patients with PE&#44; particularly when associated with right ventricular dysfunction and myocardial ischemia&#46;<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">32</span></a><ul class="elsevierStyleList" id="lis0075"><li class="elsevierStyleListItem" id="lsti0120"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0305" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Early mobilization is suggested in patients with low-risk PE&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0125"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0310" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Rest is suggested for the first few days of treatment in patients with intermediate-risk PE&#46;</span></p></li></ul></p></span><span id="sec0110" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Fibrinolytic Treatment</span><p id="par0315" class="elsevierStylePara elsevierViewall">Thrombolytic treatment accelerates clot lysis and hemodynamic improvement occurs more rapidly than with UFH treatment&#44; although there are no differences in the residual thrombosis after 5&#8211;7 days&#46; Analysis of a subgroup of patients in the Urokinase Pulmonary Embolism Trial &#40;UPET&#41;&#44; which compared urokinase followed by UFH or UFH alone&#44; showed that fibrinolytic treatment reduces mortality in patients with shock secondary to massive PE&#46;<a class="elsevierStyleCrossRef" href="#bib0165"><span class="elsevierStyleSup">33</span></a> Based on these findings&#44; and in the absence of a high risk of bleeding&#44; thrombolytic treatment is indicated in patients with acute symptomatic PE and hemodynamic instability &#40;defined as cardiogenic shock or sustained systolic blood pressure &#60;90<span class="elsevierStyleHsp" style=""></span>mmHg&#44; not due to hypovolemia&#44; sepsis or cardiac arrhythmias&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">34</span></a> Hemodynamic instability is rare&#44; but up to half of patients with PE without hemodynamic instability have clinical and echocardiographic signs of right ventricular dysfunction &#40;intermediate-risk PE&#41;&#46; Although not routinely recommended&#44;<a class="elsevierStyleCrossRef" href="#bib0175"><span class="elsevierStyleSup">35</span></a> and pending publication of the results of the Pulmonary Embolism Thrombolysis Study &#40;PEITHO&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">36</span></a> the decision to use thrombolytic treatment in a very selected group of patients will depend on their risk of bleeding and the severity of the clinical symptoms&#46;</p><p id="par0320" class="elsevierStylePara elsevierViewall">Thrombolytic treatment administered for 2<span class="elsevierStyleHsp" style=""></span>h is safer and more effective than 12&#8211;24-h regimens&#46; Streptokinase and recombinant tissue plasminogen activator &#40;rt-PA&#41; are equally effective with this short administration regimen&#46; It should be administered via a peripheral route&#46; Administration through a central line is not more effective and increases the risk of bleeding at the venous access insertion site&#46;<ul class="elsevierStyleList" id="lis0080"><li class="elsevierStyleListItem" id="lsti0130"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0325" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">The administration of systemic fibrinolytic treatment is recommended in patients with PE and cardiogenic shock&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0135"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0330" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">The administration of systemic fibrinolytic treatment is suggested in patients with PE and hypotension without a high risk of bleeding&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0140"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0335" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">It is recommended not to administer fibrinolytic treatment in most hemodynamically stable patients with PE&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0145"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0340" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">In hemodynamically stable patients with intermediate-risk PE and a low risk of bleeding&#44; particularly in the under 75<span class="elsevierStyleHsp" style=""></span>s&#44; it is suggested that the administration of fibrinolytic treatment be assessed&#46;</span></p></li></ul></p></span><span id="sec0115" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Vena Caval Filters</span><p id="par0345" class="elsevierStylePara elsevierViewall">Vena caval filters are indicated in PE patients with a contraindication for anticoagulation therapy&#46; Decousus et al&#46; published a clinical trial evaluating the usefulness of vena caval filters&#44; as a complement to conventional anticoagulation&#44; in patients with DVT and high-risk PE&#46;<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">37</span></a> The filters reduced the frequency of PE during the first 12 days of treatment&#44; and a tendency toward a lower number of fatal episodes was detected&#46; After 2 years&#44; there were no differences between the two groups in terms of mortality or recurrent VTE&#44; due to an increase in the frequency of DVT in the group treated with filters&#46; These findings indirectly support the use of vena caval filters in patients in whom anticoagulation is contraindicated in the acute phase&#46; A recoverable filter should be inserted when possible&#44; and should be removed as soon as anticoagulation can be commenced&#46;<ul class="elsevierStyleList" id="lis0085"><li class="elsevierStyleListItem" id="lsti0150"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0350" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Placement of an inferior vena caval filter is recommended in hemodynamically stable patients with PE and a contraindication for anticoagulation&#46;</span></p></li></ul></p></span><span id="sec0120" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Other Treatments</span><p id="par0355" class="elsevierStylePara elsevierViewall">In experienced centers&#44; mechanical thrombus fragmentation is performed in patients with high-risk PE and a contraindication for the use of fibrinolytics&#46; Pulmonary embolectomy is another method of treatment for high-risk PE&#46; It is indicated in cases of right-sided heart thrombi&#44; high risk of paradoxical arterial embolism or in patients with high-risk PE in whom fibrinolysis has not been effective&#46;<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">38</span></a> The results improve if patients undergo the procedure before developing cardiogenic shock&#46;<ul class="elsevierStyleList" id="lis0090"><li class="elsevierStyleListItem" id="lsti0155"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0360" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">In patients with high-risk PE and who &#40;i&#41; have a contraindication for fibrinolysis&#44; &#40;ii&#41; fibrinolysis has failed&#44; or &#40;iii&#41; the shock is likely to cause death of the patient before the fibrinolysis is effective&#44; the use of interventionist catheterization techniques or pulmonary embolectomy is suggested if the necessary resources and expertise are available&#46;</span></p></li></ul></p></span><span id="sec0125" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Support Treatment</span><p id="par0365" class="elsevierStylePara elsevierViewall">Patients with acute symptomatic PE should receive supplementary oxygen to obtain saturations higher than 92&#37;&#46; Oxygen therapy&#44; especially in patients with right-sided heart overload&#44; acts as a vasodilator and may contribute to the decrease in pressure in the pulmonary arteries&#46;</p><p id="par0370" class="elsevierStylePara elsevierViewall">Pleuritic chest pain is a common symptom in patients with PE&#46; It can be relieved on most occasions by administering non-steroidal anti-inflammatory agents within 24&#8211;48<span class="elsevierStyleHsp" style=""></span>h&#46; The administration of these drugs does not increase the risk of bleeding in acute PE&#46;</p><p id="par0375" class="elsevierStylePara elsevierViewall">The administration of fluids &#40;&#60;500<span class="elsevierStyleHsp" style=""></span>ml&#41; may be beneficial for increasing the cardiac output in patients with PE&#44; low output and sustained systemic pressures&#46; Dopamine or dobutamine can be used in patients with low output and sustained systemic pressures&#46; For hypotensive patients with PE&#44; adrenaline combines the beneficial effects of noradrenaline and dobutamine&#46;</p></span><span id="sec0130" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Treatment of Isolated Subsegmental Pulmonary Embolism</span><p id="par0380" class="elsevierStylePara elsevierViewall">A meta-analysis of studies that performed chest angio-CT for suspected PE found that the incidence of subsegmental PE was 4&#46;7&#37; &#40;95&#37; CI&#44; 2&#46;5&#8211;7&#46;6&#41; and 9&#46;4&#37; &#40;95&#37; CI&#44; 5&#46;5&#8211;14&#46;2&#41; in patients undergoing single- and multidetector CT&#46; respectively&#46;<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">39</span></a> There were no differences between the two groups in the incidence of thrombotic events during the first 3 months of follow-up when the patients did not receive anticoagulant therapy based on a negative angio-CT&#46;</p></span><span id="sec0135" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Treatment of Incidental Pulmonary Embolism</span><p id="par0385" class="elsevierStylePara elsevierViewall">Incidental PE &#40;unsuspected&#41; is detected in approximately 2&#37; of patients &#40;most with cancer&#41; in whom a chest CT is performed for reasons other than suspected PE&#46; Some indirect evidence suggests that incidental PE worsens the prognosis in these patients&#46;<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">40</span></a> The recommendation for indicating anticoagulant therapy is more consistent when the incidental PE is associated with concomitant PE&#44; the PE is lobar or in the main arteries and the risk of bleeding is not high&#46;<ul class="elsevierStyleList" id="lis0095"><li class="elsevierStyleListItem" id="lsti0160"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0390" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Anticoagulant therapy is suggested in patients with incidental PE in a segmental&#44; lobar or main location&#46;</span></p></li></ul></p></span><span id="sec0140" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Treatment of Right-Sided Heart Thrombi</span><p id="par0395" class="elsevierStylePara elsevierViewall">The presence of right-sided heart thrombi&#44; particularly when they are mobile&#44; significantly worsens the prognosis in patients with PE&#46; Some indirect evidence suggests that fibrinolysis or surgical embolectomy is more effective than conventional anticoagulant therapy in these patients&#46;</p></span></span><span id="sec0145" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Long-term Treatment of Pulmonary Thromboembolism &#40;After the First 3&#8211;6 Months&#41;</span><span id="sec0150" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0150">Duration of Treatment</span><p id="par0400" class="elsevierStylePara elsevierViewall">The appropriate duration of anticoagulant treatment requires a balance between the risk of recurrent VTE and the risk of bleeding complications&#46;</p></span><span id="sec0155" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0155">Risk of Recurrence</span><p id="par0405" class="elsevierStylePara elsevierViewall">The risk of recurrent VTE depends on &#40;1&#41; the efficacy of treatment of the acute episode&#44; &#40;2&#41; a minimum duration of long-term treatment&#44; &#40;3&#41; the possibility of the patient having an intrinsic risk factor for suffering a new VTE episode&#46;</p><p id="par0410" class="elsevierStylePara elsevierViewall">In a meta-analysis that included 2925 patients who had suffered a first episode of VTE not secondary to cancer&#44; and who had received treatment of different durations&#44; the risk of recurrence increased significantly for treatment durations less than 3 months &#40;HR 1&#46;52&#59; 95&#37; CI&#44; 1&#46;14&#8211;2&#46;02&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">41</span></a> There were no differences in the risk of recurrence for treatment durations of 3 months compared to durations of 6 or more months &#40;HR 1&#46;19&#59; 95&#37; CI&#44; 0&#46;86&#8211;1&#46;85&#41;&#46; Based on this evidence&#44; it is agreed that long-term treatment of patients with PE should have a minimum duration of 3 months&#46;</p><p id="par0415" class="elsevierStylePara elsevierViewall">In the aforementioned meta-analysis&#44;<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">41</span></a> the risk of recurrence was significantly lower for events caused by a temporary risk factor than for unprovoked events &#40;HR 0&#46;55&#59; 95&#37; CI&#44; 0&#46;41&#8211;0&#46;74&#41;&#46; In a systematic review<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">42</span></a> that included 15 clinical trials&#44; the risk of recurrent VTE during follow-up for patients with unprovoked VTE was 2&#46;3&#8211;2&#46;5 times higher than that of patients with provoked VTE&#44; 7&#46;9&#8211;10&#46;6 times higher than patients with VTE provoked by a surgical risk factor&#44; and 1&#46;4&#8211;1&#46;8 times higher than that of patients with VTE provoked by a non-surgical risk factor&#46;</p><p id="par0420" class="elsevierStylePara elsevierViewall">Although the literature is not consistent&#44; for the purpose of decision-making on treatment duration&#44; these guidelines stratify PE as provoked by a major risk factor&#44; provoked by a minor risk factor&#44; unprovoked or secondary to cancer &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>&#41;&#46;</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia><span id="sec0160" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0160">Bleeding Risk</span><p id="par0425" class="elsevierStylePara elsevierViewall">There are no bleeding risk scales that have been sufficiently validated in patients on anticoagulant therapy for an episode of VTE&#46; The RIETE registry<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">43</span></a> derived a score for predicting the risk of bleeding in the first 3 months of anticoagulant therapy from 19<span class="elsevierStyleHsp" style=""></span>274 patients diagnosed with DVT or PE &#40;<a class="elsevierStyleCrossRef" href="#tbl0040">Table 8</a>&#41;&#46; Based on the weight of each of the variables on the scale&#44; patients were classified into three risk groups&#58; low&#44; intermediate and high&#46; The incidence of major bleeding in the internal validation cohort was 0&#46;1&#37;&#44; 2&#46;8&#37; and 6&#46;2&#37;&#44; respectively&#46;</p><elsevierMultimedia ident="tbl0040"></elsevierMultimedia><p id="par0430" class="elsevierStylePara elsevierViewall">After the third month of anticoagulant therapy&#44; the evidence is more limited&#46; The 9th edition of the ACCP<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> proposes a scale for risk of bleeding from a series of variables that have been associated with bleeding events in the literature &#40;<a class="elsevierStyleCrossRef" href="#tbl0045">Table 9</a>&#41;&#46; According to this model&#44; the risk of a major bleed is low &#40;0&#46;3&#37;&#41; in the absence of any risk factor&#44; moderate &#40;0&#46;6&#37;&#41; in the presence of one risk factor&#44; and high &#40;&#8805;2&#46;5&#37;&#41; if there are two or more risk factors&#46; This model has not been validated in an external cohort of patients with VTE&#46;</p><elsevierMultimedia ident="tbl0045"></elsevierMultimedia></span><span id="sec0165" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0165">Decision Strategies</span><p id="par0435" class="elsevierStylePara elsevierViewall">Two decision strategies have been developed on the duration of long-term anticoagulation in patients with PE&#58; a population strategy and an individualized strategy&#46; The first of these only considers provoked PE&#44; unprovoked PE or PE secondary to cancer for making set recommendations on the duration of anticoagulant treatment&#46; The second takes into account the clinical characteristics of each patient &#40;age&#44; sex&#44; comorbidity&#44; presentation of the event&#41; and some other additional factor &#40;D-dimer&#41; to suggest individualized plans for duration of anticoagulant treatment&#46; The authors of these guidelines suggest a mixed approach for decision-making&#46;<ul class="elsevierStyleList" id="lis0100"><li class="elsevierStyleListItem" id="lsti0165"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0440" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">In patients with PE provoked by surgical transient risk factors&#44; 3 months of anticoagulant treatment is recommended&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0170"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0445" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">In patients with PE provoked by non-surgical transient risk factors&#44; 3 months anticoagulant treatment is suggested&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0175"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0450" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">In patients with unprovoked PE&#44; a minimum of 3&#8211;6 months anticoagulant treatment is recommended&#44; and it is suggested that indefinite treatment be assessed according to the balance between the risk of recurrence and the risk of bleeding&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0180"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0455" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">In patients with cancer&#44; at least 3&#8211;6 months anticoagulant treatment is recommended&#44; and it is suggested that the treatment be prolonged while the cancer is active&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0185"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0460" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Indefinite anticoagulant treatment is recommended in patients with a second episode of unprovoked PE&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0190"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0465" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">In patients with an indication for indefinite anticoagulation&#44; periodical reevaluation of this indication is recommended&#46;</span></p></li></ul></p></span><span id="sec0170" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0170">Individual Markers for Risk of Recurrence in Unprovoked Pulmonary Embolism</span><p id="par0470" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Event presentation</span>&#46; In a meta-analysis that included 2554 patients with PE or DVT who were followed-up for 5 years&#44; the initial presentation of the thrombotic event as PE tripled the risk that the recurrent VTE was again a PE &#40;vs DVT&#41; &#40;HR 3&#46;1&#44; 95&#37; CI&#44; 1&#46;9&#8211;5&#46;1&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">44</span></a> These results highlight the importance of presentation of the event&#44; since the mortality of PE is significantly higher than that of DVT&#46;</p><p id="par0475" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">D-dimer</span>&#46; In the PROLONG<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">45</span></a> trial&#44; D-dimer was measured 1 month after discontinuing anticoagulant therapy in patients with a first episode of unprovoked VTE who had received at least 3 months VKA treatment&#46; Patients with negative D-dimer did not receive anticoagulant therapy&#44; while those with positive D-dimer were randomized to restart or discontinue anticoagulant therapy definitively&#46; The rate of recurrent VTE during follow-up was 15&#37; in the group with positive D-dimer who stopped anticoagulant treatment&#44; 6&#46;2&#37; in the group with negative D-dimer&#44; and 2&#46;6&#37; in the group with positive D-dimer who received anticoagulant treatment&#46; These results have been confirmed in subsequent systematic reviews and meta-analyses&#46;</p><p id="par0480" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Residual deep vein thrombosis</span>&#46; Residual DVT is defined as persistence of the organized thrombus adhered to the vein wall over time&#46; In a systematic review and meta-analysis of 9 cohort studies and 5 randomized trials&#44;<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">46</span></a> it was concluded that residual DVT was modestly associated with an increase in the risk of recurrence for all patients with DVT &#40;both provoked and unprovoked&#41; &#40;OR 1&#46;5&#59; 95&#37;&#44; CI 1&#46;1&#8211;2&#46;0&#41;&#44; but the effect disappeared when only the subgroup of patients with unprovoked DVT was considered &#40;OR 1&#46;2&#59; 95&#37; CI&#44; 0&#46;9&#8211;1&#46;7&#41;&#46; Its limitation is that the evaluation is operator-dependent and interobserver variability is high&#46;</p><p id="par0485" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">First vs second episode of PE</span>&#46; After a second episode of VTE&#44; the risk of recurrence is approximately 1&#46;5 times higher than after the first episode&#46;<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">47</span></a> The risk of recurrence is particularly high when the second episode occurs shortly after discontinuing anticoagulant therapy&#46;</p><p id="par0490" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Hereditary and acquired thrombophilia</span>&#46; In a meta-analysis&#44; the risk of recurrent VTE was 1&#46;6 &#40;95&#37; CI&#44; 1&#46;1&#8211;2&#46;1&#41; for patients heterozygous for factor V Leiden &#40;1&#46;2&#59; 95&#37; CI&#44; 0&#46;6&#8211;2&#46;2&#44; for the subgroup of patients with unprovoked VTE&#41;&#44; 2&#46;6 &#40;95&#37; CI&#44; 1&#46;2&#8211;6&#46;0&#41; for homozygous patients&#44; and 1&#46;4 &#40;95&#37; CI&#44; 1&#46;0&#8211;2&#46;2&#41; for patients heterozygous for the prothrombin G20210A gene&#46;<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">48</span></a> Given that the association between hereditary thrombophilia and the risk of recurrence is weak &#40;if it exists&#41;&#44; its measurement to determine the duration of anticoagulant treatment is not recommended&#46;</p><p id="par0495" class="elsevierStylePara elsevierViewall">Studies that have evaluated the association between the presence of antiphospholipid antibodies &#40;APA&#41; and the risk of recurrent VTE do not provide consistent data for deciding the duration of anticoagulation if they are detected&#46;</p><p id="par0500" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Other risk factors of recurrence</span>&#46; Advanced age&#44; male gender&#44; obesity&#44; post-thrombotic syndrome secondary to DVT concomitant with PE&#44; some anti-psychotic drugs and certain chronic diseases such as inflammatory bowel disease have been associated with an increased risk of recurrence when anticoagulant treatment is discontinued&#46;</p></span><span id="sec0175" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0175">Predictive Models of Recurrence for Patients With Unprovoked Pulmonary Embolism</span><p id="par0505" class="elsevierStylePara elsevierViewall">Various predictive models have been developed that could identify patients with unprovoked PE and low risk of recurrence&#46; However&#44; none have been prospectively validated&#46; The most widely used models are the DASH &#40;D-Dimer&#44; Age&#44; Sex&#44; Hormonal treatment&#41; score&#44;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">49</span></a> Vienna nomogram&#44;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">50</span></a> developed with 3 variables associated independently with the risk of recurrence&#58; female sex&#44; proximal DVT vs PE and D-dimer value determined after discontinuation of anticoagulant treatment&#44; and the Canadian model&#44;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">51</span></a> valid for women&#44; which includes the following variables&#58; age&#44; body mass index&#44; D-dimer determined after discontinuing anticoagulant treatment and presence of post-thrombotic symptoms or signs in the LE&#46;</p></span></span><span id="sec0180" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0180">Drugs For Long-Term Treatment</span><p id="par0510" class="elsevierStylePara elsevierViewall">These guidelines only make recommendations or suggestions for drugs approved in Spain for this indication&#46;</p><span id="sec0185" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0185">Vitamin K Antagonists</span><p id="par0515" class="elsevierStylePara elsevierViewall">Acenocumarol and warfarin are the two dicumarol derivatives available in Spain&#46; They interfere competitively in the metabolism of vitamin K and inhibit the production of coagulation proteins dependent on this vitamin &#40;factors II&#44; VII&#44; IX and X and proteins C&#44; S and Z&#41;&#46; Acenocumarol has a shorter half-life and faster metabolic clearance than warfarin&#46; Control of the therapeutic action requires monitoring expressed as the international normalized ratio &#40;INR&#41;&#46; An INR range between 2&#46;0 and 3&#46;0 has the best balance between efficacy and safety&#44;<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">52</span></a> and reduces the risk of recurrence by 80&#37;&#46; After having completed a minimum of 6 months with a range between 2&#46;0 and 3&#46;0&#44; a clinical trial found that the administration of VKA with a lower range&#44; between 1&#46;5 and 1&#46;9&#44; reduced the risk of recurrence by 64&#37; &#40;HR 0&#46;36&#59; 95&#37; CI&#44; 0&#46;19&#8211;0&#46;67&#41; without increasing the risk of major bleeding &#40;HR 2&#46;53&#59; 95&#37; CI&#44; 0&#46;49&#8211;13&#46;03&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">53</span></a> In another clinical trial&#44; when this regimen &#40;range between 1&#46;5 and 1&#46;9&#41; was compared with the conventional regimen &#40;range between 2&#46;0 and 3&#46;0&#41;&#44; the risk of recurrence was significantly higher &#40;HR 2&#46;8&#59; 95&#37; CI&#44; 1&#46;1&#8211;7&#46;0&#41;&#44; with no differences in the risk of major bleeding &#40;HR 1&#46;2&#59; 95&#37; CI&#44; 0&#46;4&#8211;3&#46;0&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">52</span></a></p><p id="par0520" class="elsevierStylePara elsevierViewall">In patients with difficulty in regular monitoring or maintaining a stable INR with VKA &#40;more than 50&#37; of measurements within range over a 6-month period&#41;&#44; the balance between efficacy and safety of VKA is not guaranteed&#46;</p></span><span id="sec0190" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0190">Low Molecular Weight Heparins</span><p id="par0525" class="elsevierStylePara elsevierViewall">These are indicated for at least the first 3 months of treatment of VTE in patients with active cancer&#44; where they have been shown to be more effective than VKAs&#46; However&#44; as the doses for long-term treatment are not well established and their administration is parenteral&#44; their use is not recommended as first choice in patients with VTE not secondary to cancer&#44; although they could be an alternative for patients with difficulty in properly controlling VKA levels or unstable INR&#46;</p></span><span id="sec0195" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0195">New Oral Anticoagulants</span><p id="par0530" class="elsevierStylePara elsevierViewall">At the time of writing of this consensus&#44; the European Medicines Agency &#40;EMA&#41; has only approved rivaroxaban for the secondary prevention of VTE after a first episode of DVT or PE&#46; Other anticoagulants&#44; such as dabigatran or apixaban&#44; already marketed for other indications&#44; are pending approval&#46;</p><p id="par0535" class="elsevierStylePara elsevierViewall">The Einstein-Extension study<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">27</span></a> randomly assigned 1197 patients who had completed 6&#8211;12 months of anticoagulation &#40;with VKA or rivaroxaban&#41; to receive rivaroxaban at doses of 20<span class="elsevierStyleHsp" style=""></span>mg&#47;day or placebo&#46; During the study period&#44; rivaroxaban significantly reduced the risk of recurrent VTE &#40;HR 0&#46;18&#59; 95&#37; CI&#44; 0&#46;09&#8211;0&#46;39&#41;&#46; There were no significant differences in the incidence of major bleeding&#44; but rivaroxaban increased the risk of major or clinically relevant non-major bleeding &#40;HR 5&#46;19&#59; IC 95&#37;&#44; 2&#46;3&#8211;11&#46;7&#41;&#46;</p><p id="par0540" class="elsevierStylePara elsevierViewall">In the AMPLIFY-EXT trial&#44;<a class="elsevierStyleCrossRef" href="#bib0270"><span class="elsevierStyleSup">54</span></a> two doses of apixaben &#40;2&#46;5 and 5<span class="elsevierStyleHsp" style=""></span>mg&#44; twice daily&#41; were compared with placebo in patients with VTE who had completed 6&#8211;12 months of anticoagulant treatment &#40;with VKA or apixaban&#41;&#46; During the study period&#44; apixaban significantly reduced the risk of recurrent VTE &#40;relative risk &#91;RR&#93; 0&#46;19&#59; 95&#37; CI&#44; 0&#46;11&#8211;0&#46;33 for the 2&#46;5<span class="elsevierStyleHsp" style=""></span>mg dose&#59; RR 0&#46;20&#59; 95&#37; CI&#44; 0&#46;11&#8211;0&#46;34 for the 5<span class="elsevierStyleHsp" style=""></span>mg dose&#41;&#44; with no differences in the incidence of major or clinically relevant non-major bleeding &#40;RR 1&#46;20&#59; 95&#37; CI&#44; 0&#46;69&#8211;2&#46;10 for the 2&#46;5<span class="elsevierStyleHsp" style=""></span>mg dose&#59; RR 1&#46;62&#59; 95&#37; CI&#44; 0&#46;96&#8211;2&#46;73 for the 5<span class="elsevierStyleHsp" style=""></span>mg dose&#41;&#46;</p><p id="par0545" class="elsevierStylePara elsevierViewall">In two clinical trials&#44; RE-MEDY and RE-SONATE&#44;<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">55</span></a> dabigatran at a dose of 150<span class="elsevierStyleHsp" style=""></span>mg twice daily was compared with VKA and placebo &#40;respectively&#41; in patients with VTE who had completed at least 3 months of anticoagulation &#40;with VKA or dabigatran&#41;&#46; During the study period&#44; dabigatran was equally as effective as the VKAs &#40;HR 1&#46;44&#59; 95&#37; CI&#44; 0&#46;78&#8211;2&#46;64&#41; and more effective than placebo &#40;HR 0&#46;08&#59; 95&#37; CI&#44; 0&#46;02&#8211;0&#46;25&#41; in reducing recurrent VTE&#46; Dabigatran reduced the total incidence of major or clinically relevant non-major bleeding when compared with VKA &#40;HR 0&#46;54&#59; 95&#37; CI&#44; 0&#46;41&#8211;0&#46;71&#41;&#44; but these increased when compared with placebo &#40;HR 2&#46;92&#59; 95&#37; CI&#44; 1&#46;52&#8211;5&#46;60&#41;&#46;</p></span><span id="sec0200" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0200">Aspirin</span><p id="par0550" class="elsevierStylePara elsevierViewall">Two clinical trials were published in 2012&#44; WARFASA<a class="elsevierStyleCrossRef" href="#bib0280"><span class="elsevierStyleSup">56</span></a> and ASPIRE&#44;<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">57</span></a> which evaluated the efficacy and safety of aspirin compared to placebo in the secondary prevention of VTE in patients with a first unprovoked episode of PE or DVT&#46; In the WARFASA study&#44; aspirin was compared to placebo in patients with VTE who had completed a 6&#8211;18-month period of treatment with VKA &#40;DVT 63&#37;&#59; PE 37&#37;&#41;&#46; During the 2 years of follow-up&#44; aspirin significantly reduced the risk of recurrent VTE &#40;HR 0&#46;55&#59; 95&#37; CI&#44; 0&#46;33&#8211;0&#46;92&#41;&#44; without increasing bleeding episodes &#40;HR 0&#46;98&#59; 95&#37; CI&#44; 0&#46;24&#8211;3&#46;96&#41;&#46; In the ASPIRE study&#44; aspirin was compared to placebo in patients with VTE who had completed a 6-week to 24-month period of treatment with VKA&#46; No differences were observed in the rate of recurrent VTE &#40;HR 0&#46;74&#59; 95&#37; CI&#44; 0&#46;52&#8211;1&#46;09&#41;&#44; although there was an overall clinical benefit in the reduction of the composite of cardiovascular episodes&#44; bleeding&#44; and death from any cause &#40;HR 0&#46;67&#59; 95&#37; CI&#44; 0&#46;49&#8211;0&#46;91&#41;&#46;<ul class="elsevierStyleList" id="lis0105"><li class="elsevierStyleListItem" id="lsti0195"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0555" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">The use of VKA is recommended for most patients with PE&#44; with a target INR of 2&#46;5 &#40;range 2&#46;0&#8211;3&#46;0&#41;&#44; for long-term anticoagulant treatment&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0200"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0560" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">It is suggested not to use VKA with a target INR of 1&#46;5&#8211;1&#46;9 for long-term anticoagulant treatment&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0205"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0565" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">The use of LMWH is recommended for patients with PE secondary to cancer throughout treatment&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0210"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0570" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">The use of rivaroxaban for long-term anticoagulant treatment is suggested in patients with difficulty in regular monitoring or maintaining a stable INR with VKA&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0215"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0575" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">In patients with unprovoked PE in whom oral anticoagulation has been discontinued&#44; it is suggested to assess the use of aspirin&#44; at a dose of 100<span class="elsevierStyleHsp" style=""></span>mg&#47;day&#44; once the minimum treatment duration &#40;3 months&#41; has been completed&#46;</span></p></li></ul></p></span></span><span id="sec0205" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0205">Residual Thrombosis and Chronic Thromboembolic Pulmonary Hypertension</span><p id="par0580" class="elsevierStylePara elsevierViewall">In a review of 4 studies in which serial imaging tests were carried out&#44; the percentage of patients with residual PE was 87&#37; at 8 days&#44; 68&#37; at 6 weeks&#44; 65&#37; at 3 months&#44; 57&#37; at 6 months and 52&#37; at 11 months&#46;<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">58</span></a> However&#44; in a study of 673 patients from a single center who were followed-up for 3 months&#44; the rate of symptomatic recurrent VTE was only 3&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0295"><span class="elsevierStyleSup">59</span></a> Therefore&#44; there is disagreement between the percentage of patients with residual thrombosis and the percentage of patients with recurrent VTE&#46;</p><p id="par0585" class="elsevierStylePara elsevierViewall">The incidence of symptomatic chronic thromboembolic pulmonary hypertension &#40;CTEPH&#41; in patients who have had an episode of PE varies according to the series and follow-up period&#44; and has reached up to 3&#46;8&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">60</span></a> Some characteristics of the initial PE episode &#40;age &#62;70 years&#44; young age&#44; female gender&#44; pulmonary systolic pressure &#62;50<span class="elsevierStyleHsp" style=""></span>mmHg&#44; massive or sub-massive PE&#44; recurrent or idiopathic PE&#41; increase the risk of developing CTEPH&#46;<a class="elsevierStyleCrossRef" href="#bib0305"><span class="elsevierStyleSup">61</span></a><ul class="elsevierStyleList" id="lis0110"><li class="elsevierStyleListItem" id="lsti0220"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0590" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">In patients with a history of PE&#44; it is recommended not to use thoracic imaging tests to evaluate the persistence of residual thrombosis or reperfusion of the initial defects&#46;</span></p></li><li class="elsevierStyleListItem" id="lsti0225"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0595" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">In patients with a history of PE and signs or symptoms suggestive of CTEPH&#44; it is recommended to perform a follow-up transthoracic echocardiogram&#46;</span></p></li></ul></p></span><span id="sec0210" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0210">Search for Occult Neoplasm in Unprovoked Pulmonary Embolism</span><p id="par0600" class="elsevierStylePara elsevierViewall">VTE is associated with an occult neoplasm in approximately 10&#37; of patients&#46; The Trousseau study<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">62</span></a> compared the utility of extensive screening for cancer by thoracoabdominal CT and mammography &#40;in women&#41; with limited screening&#46; The results did not show any differences in the incidence of cancer or mortality between the two patient groups&#46; Extensive screening significantly increased the healthcare costs due to the additional diagnostic process associated with false positive results&#46;<ul class="elsevierStyleList" id="lis0115"><li class="elsevierStyleListItem" id="lsti0230"><span class="elsevierStyleLabel"><span class="elsevierStyleItalic">&#8226;</span></span><p id="par0605" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">In patients with an episode of unprovoked PE&#44; it is suggested not to perform specific tests searching for neoplasia if there are no clinical symptoms or basic complementary examinations that suggest the presence of this disease&#46;</span></p></li></ul></p></span></span><span id="sec0215" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0215">Conflicts of Interest</span><p id="par0610" class="elsevierStylePara elsevierViewall">Fernando Uresandi has received funding for giving lectures at educational events and&#47;or scientific advice and&#47;or research from Bayer HealthCare Pharmaceuticals&#46;</p><p id="par0615" class="elsevierStylePara elsevierViewall">Manuel Monreal has received funding for giving lectures at educational events and&#47;or scientific advice and&#47;or research from Bayer HealthCare Pharmaceuticals&#59; Boehringer Ingelheim Pharmaceuticals&#44; Inc&#46;&#59; Daiichi Sankyo&#44; Inc&#59; Pfizer&#59; ROVI&#59; Sanofi-Aventis&#46;</p><p id="par0620" class="elsevierStylePara elsevierViewall">Ferr&#225;n Garc&#237;a-Bragado has received funding for giving lectures at educational events and&#47;or scientific advice and&#47;or research from Bayer HealthCare Pharmaceuticals&#59; Boehringer Ingelheim Pharmaceuticals&#44; Inc&#46;&#59; Bristol-Myers Squibb Company&#59; Daiichi Sankyo&#44; Inc&#59; ROVI&#59; Sanofi-Aventis&#46;</p><p id="par0625" class="elsevierStylePara elsevierViewall">Ram&#243;n Lecumberri has received funding for giving lectures at educational events and&#47;or scientific advice and&#47;or research from Bayer HealthCare Pharmaceuticals&#59; Boehringer Ingelheim Pharmaceuticals&#44; Inc&#46;&#59; Bristol-Myers Squibb Company&#59; Leo Pharma&#59; ROVI&#59; Sanofi-Aventis&#46;</p><p id="par0630" class="elsevierStylePara elsevierViewall">Sonia Jim&#233;nez has received funding for giving lectures at educational events and&#47;or scientific advice and&#47;or research from Bayer HealthCare Pharmaceuticals&#59; Boehringer Ingelheim Pharmaceuticals&#44; Inc&#46;&#59; ROVI&#59; Sanofi-Aventis&#46;</p><p id="par0635" class="elsevierStylePara elsevierViewall">Pedro Ruiz-Artacho has received funding for giving lectures at educational events and&#47;or scientific advice and&#47;or research from Bayer HealthCare Pharmaceuticals&#59; LeoPharma&#59; Sanofi-Aventis&#46;</p><p id="par0640" class="elsevierStylePara elsevierViewall">Francisco Lozano has received funding for giving lectures at educational events and&#47;or scientific advice and&#47;or research from Bayer HealthCare Pharmaceuticals&#59; Bristol-Myers Squibb Company&#59; Leo Pharma&#59; ROVI&#59; Sanofi-Aventis&#46;</p><p id="par0645" class="elsevierStylePara elsevierViewall">Antonio Romera has received funding for giving lectures at educational events and&#47;or scientific advice and&#47;or research from Bayer HealthCare Pharmaceuticals&#59; Leo Pharma&#59; ROVI&#59; Sanofi-Aventis&#46;</p><p id="par0650" class="elsevierStylePara elsevierViewall">David Jim&#233;nez has received funding for giving lectures at educational events and&#47;or scientific advice and&#47;or research from Bayer HealthCare Pharmaceuticals&#59; Boehringer Ingelheim Pharmaceuticals&#44; Inc&#46;&#59; Bristol-Myers Squibb Company&#59; Daiichi Sankyo&#44; Inc&#59; Leo Pharma&#59; ROVI&#59; Sanofi-Aventis&#46;</p><p id="par0655" class="elsevierStylePara elsevierViewall">Pere Domenech has received funding for giving lectures at educational events and&#47;or scientific advice and&#47;or research from Bayer HealthCare Pharmaceuticals&#59; Boehringer Ingelheim Pharmaceuticals&#44; Inc&#46;&#59; Bristol-Myers Squibb Company&#59; Leo Pharma&#59; ROVI&#59; Sanofi-Aventis&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:8 [
        0 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        1 => array:2 [
          "identificador" => "sec0010"
          "titulo" => "Concept&#44; Pathogenesis&#44; Risk Factors and Epidemiology"
        ]
        2 => array:3 [
          "identificador" => "sec0015"
          "titulo" => "Diagnosis"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0225"
              "titulo" => "Clinical Suspicion"
            ]
            1 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "D-Dimer"
            ]
            2 => array:3 [
              "identificador" => "sec0030"
              "titulo" => "Imaging Tests"
              "secciones" => array:5 [
                0 => array:2 [
                  "identificador" => "sec0035"
                  "titulo" => "Multidetector Computed Tomography Angiography"
                ]
                1 => array:2 [
                  "identificador" => "sec0040"
                  "titulo" => "Lung Scintigraphy"
                ]
                2 => array:2 [
                  "identificador" => "sec0045"
                  "titulo" => "Lower Extremity Venous Ultrasound"
                ]
                3 => array:2 [
                  "identificador" => "sec0050"
                  "titulo" => "Pulmonary Magnetic Resonance Angiography"
                ]
                4 => array:2 [
                  "identificador" => "sec0055"
                  "titulo" => "Transthoracic Echocardiography"
                ]
              ]
            ]
          ]
        ]
        3 => array:3 [
          "identificador" => "sec0060"
          "titulo" => "Prognostic Stratification of Patients With Pulmonary Embolism"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "Prognostic Factors"
            ]
            1 => array:2 [
              "identificador" => "sec0070"
              "titulo" => "Identification of Patients With Low-Risk Pulmonary Embolism"
            ]
            2 => array:2 [
              "identificador" => "sec0075"
              "titulo" => "Identification of Patients With Intermediate-Risk Pulmonary Embolism"
            ]
          ]
        ]
        4 => array:3 [
          "identificador" => "sec0080"
          "titulo" => "Treatment of Pulmonary Embolism in the Initial Phase &#40;Acute Phase And up to 3&#8211;6 Months&#41;"
          "secciones" => array:12 [
            0 => array:2 [
              "identificador" => "sec0085"
              "titulo" => "Anticoagulation With Unfractionated Heparin&#44; Low Molecular Weight Heparins or Fondaparinux"
            ]
            1 => array:2 [
              "identificador" => "sec0090"
              "titulo" => "Beginning Oral Anticoagulation"
            ]
            2 => array:2 [
              "identificador" => "sec0095"
              "titulo" => "New Oral Anticoagulants"
            ]
            3 => array:2 [
              "identificador" => "sec0100"
              "titulo" => "Early vs Standard Discharge in Pulmonary Embolism Patients"
            ]
            4 => array:2 [
              "identificador" => "sec0105"
              "titulo" => "Early Mobilization vs Rest in Acute Pulmonary Embolism"
            ]
            5 => array:2 [
              "identificador" => "sec0110"
              "titulo" => "Fibrinolytic Treatment"
            ]
            6 => array:2 [
              "identificador" => "sec0115"
              "titulo" => "Vena Caval Filters"
            ]
            7 => array:2 [
              "identificador" => "sec0120"
              "titulo" => "Other Treatments"
            ]
            8 => array:2 [
              "identificador" => "sec0125"
              "titulo" => "Support Treatment"
            ]
            9 => array:2 [
              "identificador" => "sec0130"
              "titulo" => "Treatment of Isolated Subsegmental Pulmonary Embolism"
            ]
            10 => array:2 [
              "identificador" => "sec0135"
              "titulo" => "Treatment of Incidental Pulmonary Embolism"
            ]
            11 => array:2 [
              "identificador" => "sec0140"
              "titulo" => "Treatment of Right-Sided Heart Thrombi"
            ]
          ]
        ]
        5 => array:3 [
          "identificador" => "sec0145"
          "titulo" => "Long-term Treatment of Pulmonary Thromboembolism &#40;After the First 3&#8211;6 Months&#41;"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "sec0150"
              "titulo" => "Duration of Treatment"
            ]
            1 => array:3 [
              "identificador" => "sec0155"
              "titulo" => "Risk of Recurrence"
              "secciones" => array:4 [
                0 => array:2 [
                  "identificador" => "sec0160"
                  "titulo" => "Bleeding Risk"
                ]
                1 => array:2 [
                  "identificador" => "sec0165"
                  "titulo" => "Decision Strategies"
                ]
                2 => array:2 [
                  "identificador" => "sec0170"
                  "titulo" => "Individual Markers for Risk of Recurrence in Unprovoked Pulmonary Embolism"
                ]
                3 => array:2 [
                  "identificador" => "sec0175"
                  "titulo" => "Predictive Models of Recurrence for Patients With Unprovoked Pulmonary Embolism"
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "sec0180"
              "titulo" => "Drugs For Long-Term Treatment"
              "secciones" => array:4 [
                0 => array:2 [
                  "identificador" => "sec0185"
                  "titulo" => "Vitamin K Antagonists"
                ]
                1 => array:2 [
                  "identificador" => "sec0190"
                  "titulo" => "Low Molecular Weight Heparins"
                ]
                2 => array:2 [
                  "identificador" => "sec0195"
                  "titulo" => "New Oral Anticoagulants"
                ]
                3 => array:2 [
                  "identificador" => "sec0200"
                  "titulo" => "Aspirin"
                ]
              ]
            ]
            3 => array:2 [
              "identificador" => "sec0205"
              "titulo" => "Residual Thrombosis and Chronic Thromboembolic Pulmonary Hypertension"
            ]
            4 => array:2 [
              "identificador" => "sec0210"
              "titulo" => "Search for Occult Neoplasm in Unprovoked Pulmonary Embolism"
            ]
          ]
        ]
        6 => array:2 [
          "identificador" => "sec0215"
          "titulo" => "Conflicts of Interest"
        ]
        7 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2013-05-11"
    "fechaAceptado" => "2013-07-19"
    "NotaPie" => array:4 [
      0 => array:3 [
        "etiqueta" => "1"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0035">General Coordinators&#58; Fernando Uresandi and David Jimenez&#46;</p>"
        "identificador" => "fn1"
      ]
      1 => array:2 [
        "etiqueta" => "&#9734;"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0025">Please cite this article as&#58; Uresandi F&#44; Monreal M&#44; Garc&#237;a-Bragado F&#44; Domenech P&#44; Lecumberri R&#44; Escribano P&#44; et al&#46; Consenso nacional sobre el diagn&#243;stico&#44; estratificaci&#243;n de riesgo y tratamiento de los pacientes con tromboembolia pulmonar&#46; Arch Bronconeumol&#46; 2013&#59;49&#58;534&#8211;547&#46;</p>"
      ]
      2 => array:2 [
        "etiqueta" => "&#9734;&#9734;"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0030">In this consensus document have participated the following scientific societies&#58; Spanish Society of Pneumology and Thoracic Surgery &#40;SEPAR&#41;&#59; Society Espa&#241;ola Internal Medicine &#40;SEMI&#41;&#59; Spanish Society of Thrombosis and Haemostasis &#40;SETH&#41;&#59; Spanish Society of Cardiology &#40;ESC&#41;&#59; Spanish Society of Medicine Accident and Emergency &#40;SEMES&#41;&#59; Spanish Society of Angiology and Surgery Vascular &#40;SEACV&#41;&#46;</p>"
      ]
      3 => array:3 [
        "etiqueta" => "2"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0040">A complete list of participating authors is available in the appendix&#46;</p>"
        "identificador" => "fn2"
      ]
    ]
    "apendice" => array:1 [
      0 => array:1 [
        "seccion" => array:1 [
          0 => array:4 [
            "apendice" => "<p id="par0660" class="elsevierStylePara elsevierViewall">SEACV&#58; Sergi Bellmunt&#44; Jorge Cuenca&#44; &#193;lvaro Fern&#225;ndez&#44; Fidel Fern&#225;ndez&#44; Vicente Ib&#225;&#241;ez&#44; Francisco Lozano&#44; Jos&#233; Ram&#243;n March&#44; Antonio Romera&#59; SEC&#58; Luis Almenar&#44; Antonio Castro&#44; Pilar Escribano&#44; Mar&#237;a L&#225;zaro&#44; Jos&#233; Luis Zamorano&#59; SEMES&#58; Jos&#233; Ram&#243;n Alonso&#44; Jos&#233; Ram&#243;n Casal&#44; Jos&#233; Miguel Franco&#44; Sonia Jim&#233;nez&#44; Marta Merlo&#44; Ram&#243;n Perales&#44; Pascual Pi&#241;era&#44; Pedro Ruiz-Artacho&#59; Coral Suero&#59; SEMI&#58; Raquel Barba&#44; Carmen Fern&#225;ndez-Capit&#225;n&#44; Ferr&#225;n Garc&#237;a-Bragado&#44; Vicente G&#243;mez&#44; Manuel Monreal&#44; Jos&#233; Antonio Nieto&#44; Antoni Riera-Mestre&#44; Carmen Su&#225;rez&#44; Javier Trujillo-Santos&#59; SEPAR&#58; Francisco Conget&#44; Luis Jara&#44; David Jim&#233;nez&#44; Jos&#233; Luis Lobo&#44; Javier de Miguel&#44; Dolores Nauffal&#44; Mikel Oribe&#44; Remedios Otero&#44; Fernando Uresandi&#59; SETH&#58; Pere Domenech&#44; Jos&#233; Ram&#243;n Gonz&#225;lez-Porras&#44; Ram&#243;n Lecumberri&#44; Pilar Llamas&#44; Eva Mingot&#44; Elena Pina&#44; Javier Rodr&#237;guez-Martorell&#46;</p>"
            "etiqueta" => "Appendix I"
            "titulo" => "Participating authors &#40;alphabetical order&#41;"
            "identificador" => "sec0220"
          ]
        ]
      ]
    ]
    "multimedia" => array:13 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 4041
            "Ancho" => 2253
            "Tamanyo" => 312359
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Diagnostic algorithm for the hemodynamically stable outpatient&#46; &#40;A&#41; Angio-CT&#44; computed tomography angiography&#46; <span class="elsevierStyleSup">1</span>Refers to high sensitivity D-dimer&#46; In the case of less sensitive D-dimer&#44; PE can only be ruled out in patients with low clinical probability or PE unlikely&#46; <span class="elsevierStyleSup">2</span>In case of high clinical probability and negative multidetector angio-CT&#44; additional diagnostic tests are suggested &#40;V&#47;Q scan and&#47;or Doppler ultrasound of lower extremities&#41;&#46; &#40;B&#41; DVT&#44; deep vein thrombosis&#46; <span class="elsevierStyleSup">1</span>Refers to low or intermediate probability V&#47;Q scans&#46; <span class="elsevierStyleSup">2</span>In case of high clinical probability&#44; inconclusive perfusion scan&#44; and negative ultrasound of lower extremities&#44; the need for multidetector angio-CT should be assessed with the appropriate specialist&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1862
            "Ancho" => 2503
            "Tamanyo" => 187810
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Diagnostic algorithm for the hemodynamically unstable patient with suspected pulmonary embolism&#46; Angio-CT&#44; computed tomography angiography&#59; PE&#44; pulmonary embolism&#59; RV&#44; right ventricle&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 2263
            "Ancho" => 3137
            "Tamanyo" => 354485
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Prognostic stratification and treatment of acute pulmonary embolism&#46; &#42;Cardiogenic shock or sustained systolic blood pressure &#60;90<span class="elsevierStyleHsp" style=""></span>mmHg&#44; not due to hypovolemia&#44; sepsis or cardiac arrhythmias&#46; The broken line indicates absence of definitive evidence &#40;fibrinolysis&#41; or extensive clinical experience &#40;rivaroxaban&#41;&#46; For situations not considered in the algorithm&#44; hospitalization and conventional anticoagulant therapy is recommended&#46; BNP&#44; brain natriuretic peptide&#59; DVT&#44; deep vein thrombosis&#59; Fx&#44; fondaparinux&#59; HFABP&#44; heart fatty acid binding protein&#59; hsTnT&#44; high sensitivity troponin T&#59; ICU&#44; intensive care unit&#59; LMWH&#44; low molecular weight heparin&#59; PE&#44; pulmonary embolism&#59; PESI&#44; Pulmonary Embolism Severity Index&#59; RVD&#44; right ventricular dysfunction&#59; sPESI&#44; simplified PESI&#59; UFH&#44; unfractionated heparin&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Fig&#46; 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 840
            "Ancho" => 1621
            "Tamanyo" => 66548
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Risk of recurrence according to the pulmonary embolism precipitating factor&#46;</p>"
        ]
      ]
      4 => array:7 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">DVT&#44; deep vein thrombosis&#59; LE&#44; lower extremities&#59; PE&#44; pulmonary embolism&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">High risk</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Hip or knee prosthesis or fracture&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Major surgery&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Multiple trauma&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Spinal damage&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Moderate risk</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Plaster cast immobilization of LE&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Stroke with paralysis of LE&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Puerperium&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Previous PE or DVT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Estrogenic drugs or devices&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Thrombophilia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Cancer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Chemotherapy&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Anti-psychotic drugs&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Inflammatory bowel disease&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Knee arthroscopy&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Central venous catheters or devices&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Low risk</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Advanced age&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Laparoscopic surgery&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Bed rest &#62;3 days&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Long trips of &#62;6&#8211;8<span class="elsevierStyleHsp" style=""></span>h&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Morbid obesity&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Varicose veins&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Pregnancy&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab431814.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Risk Factors for Venous Thromboembolism&#46;</p>"
        ]
      ]
      5 => array:7 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Chest X-ray&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Electrocardiogram&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Normal &#8776;50&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Normal &#8776;50&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Small pleural effusion&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sinus tachycardia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Opacities &#40;areas of pulmonary infarction&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Right precordial T-wave inversion&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Hampton&#39;s hump&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Right bundle branch block&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Linear atelectasis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">S1Q3T3 pattern&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Local oligaemia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Cardiac arrhythmias&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Slight elevation of the hemidiaphragm&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Increase in pulmonary arteries&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Cardiomegaly&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab431812.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Chest X-ray and Electrocardiogram in Acute Symptomatic Pulmonary Embolism&#46;</p>"
        ]
      ]
      6 => array:7 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0105" class="elsevierStyleSimplePara elsevierViewall">DVT&#44; deep vein thrombosis&#59; LE&#44; lower extremities&#59; PE&#44; pulmonary embolism&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Score&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Wells Score</span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Alternative diagnosis less likely than PE</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Signs or symptoms of DVT</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">History of PE or DVT</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Immobilization for at least 3 days or surgery in the previous month</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Heart rate &#62;100 beats&#47;min</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Hemoptysis</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Active cancer &#40;treatment ongoing&#44; within previous 6 months or palliative&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">For high sensitivity D-dimer&#58;</span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>Low probability&#58; &#60;2 points<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>Intermediate probability&#58; 2&#8211;6 points<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>High probability&#58; &#8805;6 points<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">For lower sensitivity D-dimer&#58;</span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>PE unlikely&#58; &#8804;4 points<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>PE likely&#58; &#62;4 points&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Geneva Score</span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Age &#62;65 years</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Previous DVT or PE</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Surgery under general anesthesia or fracture &#8804;1 month</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Active cancer&#44; solid or hematologic&#44; or considered cured &#8804;1 year</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Unilateral lower limb pain</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Hemoptysis</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Heart rate 75&#8211;94 beats&#47;min</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Heart rate &#8805;95 beats&#47;min</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Pain on LE palpation and unilateral edema</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Low probability&#58; 0&#8211;3 points</span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Intermediate probability&#58; 4&#8211;10 points</span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">High probability&#58; &#8805;11 points</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab431811.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Scoring Scales for Grading the Clinical Likelihood of Acute Symptomatic Pulmonary Embolism&#46;</p>"
        ]
      ]
      7 => array:7 [
        "identificador" => "tbl0020"
        "etiqueta" => "Table 4"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">ELFA&#44; enzyme-linked fluorescence assay&#59; ELISA&#44; enzyme-linked immunosorbent assay&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Sensitivity&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Method&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Laboratory Test<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">&#42;</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">High&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ELISA &#40;gold standard&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Asserachrom<span class="elsevierStyleSup">&#174;</span> &#40;Diagnostica Stago&#41;Dimertest Gold EIA<span class="elsevierStyleSup">&#174;</span> &#40;Agen Biomedical&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ELFA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">VIDAS<span class="elsevierStyleSup">&#174;</span> &#40;BioMerieux&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Latex-enhanced immunoturbidimetry&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">IL test<span class="elsevierStyleSup">&#174;</span> &#40;Instrumentation Laboratory&#44; SpA&#41;Liatest<span class="elsevierStyleSup">&#174;</span> &#40;Diagnostica Stago&#41;Auto Dimertest &#40;Agen Biomedical&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Moderate&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Whole blood immunoassay &#40;red cell agglutination&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SimpliRED<span class="elsevierStyleSup">&#174;</span> &#40;Agen Biomedical&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Low&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Latex immunoagglutination&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Dimertest<span class="elsevierStyleSup">&#174;</span> &#40;Agen Biomedical&#41;D-Dimer test<span class="elsevierStyleSup">&#174;</span> &#40;Diagnostica Stago&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab431817.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Laboratory test generally used in Spain&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">D-Dimer Measurement Techniques for Acute Symptomatic Pulmonary Thromboembolism&#46;</p>"
        ]
      ]
      8 => array:7 [
        "identificador" => "tbl0025"
        "etiqueta" => "Table 5"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Angio-CT&#44; computed tomography angiography&#59; BNP&#44; brain natriuretic peptide&#59; cTnI&#44; cardiac troponin I&#59; cTnT&#44; cardiac troponin T&#59; DVT&#44; deep vein thrombosis&#59; HFABP&#44; heart fatty acid binding protein&#59; hsTnT&#44; high sensitivity troponin T&#59; PESI&#44; Pulmonary Embolism Severity Index&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Clinical markers&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">PESI ScoreSimplified PESI Score&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Markers of right ventricular dysfunction&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Transthoracic echocardiographyAngio-CTBNP or NT-proBNP<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">&#42;</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Markers of thrombotic burden&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Residual DVTD-Dimer<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">&#42;</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Markers of tissue damage&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Lactate<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">&#42;</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Markers of myocardial damage&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">cTnI or cTnT<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">&#42;</span></a>hsTnT<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">&#42;</span></a>HFABP<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">&#42;</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab431818.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0010"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0010">Measurement methods and cut-off points according to local practices&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Prognostic Tools for Hemodynamically Stable Patients With Acute Symptomatic Pulmonary Embolism&#46;</p>"
        ]
      ]
      9 => array:7 [
        "identificador" => "tbl0030"
        "etiqueta" => "Table 6"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Variable&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Points&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">PESI Score &#40;Pulmonary Embolism Severity Index&#41;</span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Age</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#47;year&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Male gender</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Cancer</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">30&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Heart failure</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Chronic lung disease</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Heart rate &#8805;110 beats&#47;min</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Systolic blood pressure &#60;100</span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">mmHg</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">30&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Respiratory rate &#8805;30 breaths&#47;min</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Temperature &#60;36</span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">&#176;C</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Altered mental status</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">O</span><span class="elsevierStyleInf"><span class="elsevierStyleItalic">2</span></span><span class="elsevierStyleItalic">saturation &#60;90&#37;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Risk stratification&#58;</span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>Class I &#40;very low risk&#41;&#58; &#60;65 points<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>Class II &#40;low risk&#41;&#58; 66&#8211;85 points<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>Class III &#40;intermediate risk&#41;&#58; 86&#8211;105 points<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>Class IV &#40;high risk&#41;&#58; 106&#8211;125 points<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>Class V &#40;very high risk&#41;&#58; &#62;125 points&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Simplified PESI Score</span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Age &#62;80 years</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Cancer</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Chronic cardiopulmonary disease</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Heart rate &#8805;110 beats&#47;min</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Systolic blood pressure &#60;100</span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">mmHg</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">O</span><span class="elsevierStyleInf"><span class="elsevierStyleItalic">2</span></span><span class="elsevierStyleItalic">saturation &#60;90&#37;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">Risk stratification&#58;</span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>Low risk&#58; 0 points<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span>High risk&#58; &#8805;1 point&#40;s&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab431813.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Prognostic Scores in Patients With Acute Symptomatic Pulmonary Embolism&#46;</p>"
        ]
      ]
      10 => array:7 [
        "identificador" => "tbl0035"
        "etiqueta" => "Table 7"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">IU&#44; international units&#59; rt-P&#44; recombinant tissue plasminogen activator&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Active substance&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Dose&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Interval&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Bemiparin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">115<span class="elsevierStyleHsp" style=""></span>IU&#47;kg&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Every 24<span class="elsevierStyleHsp" style=""></span>h&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Dalteparin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100<span class="elsevierStyleHsp" style=""></span>IU&#47;kg200<span class="elsevierStyleHsp" style=""></span>IU&#47;kg&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Every 12<span class="elsevierStyleHsp" style=""></span>hEvery 24<span class="elsevierStyleHsp" style=""></span>h&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Enoxaparin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;0<span class="elsevierStyleHsp" style=""></span>mg&#47;kg1&#46;5<span class="elsevierStyleHsp" style=""></span>mg&#47;kg&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Every 12<span class="elsevierStyleHsp" style=""></span>hEvery 24<span class="elsevierStyleHsp" style=""></span>h&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Nadroparin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">85&#46;5<span class="elsevierStyleHsp" style=""></span>IU&#47;kg171<span class="elsevierStyleHsp" style=""></span>IU&#47;kg&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Every 12<span class="elsevierStyleHsp" style=""></span>hEvery 24<span class="elsevierStyleHsp" style=""></span>h&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Tinzaparin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">175<span class="elsevierStyleHsp" style=""></span>IU&#47;kg&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Every 24<span class="elsevierStyleHsp" style=""></span>h&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Fondaparinux&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#46;0<span class="elsevierStyleHsp" style=""></span>mg &#40;&#60;50<span class="elsevierStyleHsp" style=""></span>kg&#41;7&#46;5<span class="elsevierStyleHsp" style=""></span>mg &#40;50&#8211;100<span class="elsevierStyleHsp" style=""></span>kg&#41;10<span class="elsevierStyleHsp" style=""></span>mg &#40;&#62;100<span class="elsevierStyleHsp" style=""></span>kg&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Every 24<span class="elsevierStyleHsp" style=""></span>h&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Rivaroxaban&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15<span class="elsevierStyleHsp" style=""></span>mg &#40;days 1&#8211;21&#41;20<span class="elsevierStyleHsp" style=""></span>mg &#40;starting from day 22&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Every 12<span class="elsevierStyleHsp" style=""></span>hEvery 24<span class="elsevierStyleHsp" style=""></span>h&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Unfractionated heparin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">18<span class="elsevierStyleHsp" style=""></span>U&#47;kg&#47;h&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Perfusion&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">rt-PA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100<span class="elsevierStyleHsp" style=""></span>mg0&#46;6<span class="elsevierStyleHsp" style=""></span>mg&#47;kg&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">In 2<span class="elsevierStyleHsp" style=""></span>hIn 15<span class="elsevierStyleHsp" style=""></span>min&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Urokinase&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 million IU&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">In 2<span class="elsevierStyleHsp" style=""></span>h&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Streptokinase&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;5 million IU&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">In 2<span class="elsevierStyleHsp" style=""></span>h&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab431810.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0015"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0015">Only drugs with approval for this indication are included&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Treatment Guidelines for the Acute Phase of Pulmonary Embolism&#46;<a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">&#42;</span></a></p>"
        ]
      ]
      11 => array:7 [
        "identificador" => "tbl0040"
        "etiqueta" => "Table 8"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0090" class="elsevierStyleSimplePara elsevierViewall">DVT&#44; deep vein thrombosis&#59; PE&#44; pulmonary embolism&#59; RIETE&#44; Computerized Registry of Patients with Venous Thromboembolism&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">RIETE Score&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Score&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Recent major bleed &#40;1 month&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Creatinine &#62;1&#46;2<span class="elsevierStyleHsp" style=""></span>mg&#47;dl&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anemia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Cancer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Clinical presentation as PE &#40;vs DVT&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Age &#62;75 years&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Low risk&#58; 0&#8211;3 points<span class="elsevierStyleHsp" style=""></span>Intermediate risk&#58; 1&#8211;4 points<span class="elsevierStyleHsp" style=""></span>High risk&#58; &#62;4 points&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab431816.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0085" class="elsevierStyleSimplePara elsevierViewall">RIETE Score for Bleeding Risk in Patients With Venous Thromboembolism During the First 3 Months of Anticoagulant Treatment&#46;</p>"
        ]
      ]
      12 => array:7 [
        "identificador" => "tbl0045"
        "etiqueta" => "Table 9"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0100" class="elsevierStyleSimplePara elsevierViewall">ACCP&#44; American College of Chest Physicians&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" style="border-bottom: 2px solid black">Variable&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Age &#62;65 years&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Age &#62;75 years&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Previous bleed&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Cancer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Cancer with metastasis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Renal failure&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Liver failure&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Thrombocytopenia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Previous stroke&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Diabetes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anemia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anti-platelet therapy&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Poorly controlled anticoagulation&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Comorbidity and reduced functional capacity&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Recent surgery&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Frequent falls&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Alcohol abuse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Low risk&#58; 0 risk factors<span class="elsevierStyleHsp" style=""></span>Moderate risk&#58; 1 risk factor<span class="elsevierStyleHsp" style=""></span>High risk&#58; &#8805;2 risk factors&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab431815.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0020"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0020">Adapted from Ref&#46;<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a></p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0095" class="elsevierStyleSimplePara elsevierViewall">ACCP Score for Bleeding Risk in Patients on Anticoagulant Therapy for More Than 3 Months Due to Venous Thromboembolic Disease&#46;<a class="elsevierStyleCrossRef" href="#tblfn0020"><span class="elsevierStyleSup">&#42;</span></a></p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:62 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Antithrombotic therapy for VTE disease&#58; antithrombotic therapy and prevention of thrombosis&#44; 9th ed&#58; American College of Chest Physicians Evidence-Based Clinical Practice Guidelines"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; Kearon"
                            1 => "E&#46;A&#46; Akl"
                            2 => "A&#46;J&#46; Comerota"
                            3 => "P&#46; Prandoni"
                            4 => "H&#46; Bounameaux"
                            5 => "S&#46;Z&#46; Goldhaber"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Chest"
                        "fecha" => "2012"
                        "volumen" => "141"
                        "paginaInicial" => "419S"
                        "paginaFinal" => "494S"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "National Institute for Health and Clinical Excellence&#46; CG144 venous thromboembolic diseases&#58; the management of venous thromboembolic diseases and the role of thrombophilia testing&#46; NICE clinical guidelines 2012 &#91;accessed Feb 2013&#93;&#46; Available at&#58; <a id="intr0010" class="elsevierStyleInterRef" href="http://www.nice.org.uk/guidance/cg">www&#46;nice&#46;org&#46;uk&#47;guidance&#47;cg</a>&#46;"
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "An official ATS statement&#58; grading the quality of evidence and strength of recommendations in ATS guidelines and recommendations"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46;J&#46; Sch&#252;nemann"
                            1 => "R&#46; Jaeschke"
                            2 => "D&#46;J&#46; Cook"
                            3 => "W&#46;F&#46; Bria"
                            4 => "A&#46;A&#46; El-Solh"
                            5 => "A&#46; Ernst"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1164/rccm.200602-197ST"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Respir Crit Care Med"
                        "fecha" => "2006"
                        "volumen" => "174"
                        "paginaInicial" => "605"
                        "paginaFinal" => "614"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16931644"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Appropriateness of diagnostic management and outcomes of suspected pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46;M&#46; Roy"
                            1 => "G&#46; Meyer"
                            2 => "B&#46; Vielle"
                            3 => "C&#46; le Gall"
                            4 => "F&#46; Verschuren"
                            5 => "F&#46; Carpentier"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Intern Med"
                        "fecha" => "2006"
                        "volumen" => "144"
                        "paginaInicial" => "157"
                        "paginaFinal" => "164"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16461959"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "VIDAS D-dimer in combination with clinical pre-test probability to rule out pulmonary embolism&#46; A systematic review of management outcome studies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Carrier"
                            1 => "M&#46; Righini"
                            2 => "R&#46;K&#46; Djurabi"
                            3 => "M&#46;V&#46; Huisman"
                            4 => "A&#46; Perrier"
                            5 => "P&#46;S&#46; Wells"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Thromb Haemost"
                        "fecha" => "2009"
                        "volumen" => "101"
                        "paginaInicial" => "886"
                        "paginaFinal" => "892"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19404542"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Safety of ruling out acute pulmonary embolism by normal computed tomography in patients with an indication for computed tomography&#58; systematic review and meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "I&#46;C&#46; Mos"
                            1 => "F&#46;A&#46; Klok"
                            2 => "L&#46;J&#46; Kroft"
                            3 => "A&#46; de Roos"
                            4 => "O&#46;M&#46; Dekkers"
                            5 => "M&#46;V&#46; Huisman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1538-7836.2009.03518.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Thromb Haemost"
                        "fecha" => "2009"
                        "volumen" => "7"
                        "paginaInicial" => "1491"
                        "paginaFinal" => "1498"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19552684"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Multidetector computed tomography for acute pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46;D&#46; Stein"
                            1 => "S&#46;E&#46; Fowler"
                            2 => "L&#46;R&#46; Goodman"
                            3 => "A&#46; Gottschalk"
                            4 => "C&#46;A&#46; Hales"
                            5 => "R&#46;D&#46; Hulla"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa052367"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2006"
                        "volumen" => "354"
                        "paginaInicial" => "2317"
                        "paginaFinal" => "2327"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16738268"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "Radiological Society of North America 2013 &#91;accessed Feb 2013&#93;&#46; Available at&#58; <a id="intr0015" class="elsevierStyleInterRef" href="http://www.radiologyinfo.org/">www&#46;radiologyinfo&#46;org</a>&#46;"
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "American Thoracic Society documents&#58; an official American Thoracic Society&#47;Society of Thoracic Radiology Clinical Practice guideline evaluation of suspected pulmonary embolism in pregnancy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46;N&#46; Leung"
                            1 => "T&#46;M&#46; Bull"
                            2 => "R&#46; Jaeschke"
                            3 => "C&#46;J&#46; Lockwood"
                            4 => "P&#46;M&#46; Boiselle"
                            5 => "L&#46;M&#46; Hurwitz"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1148/radiol.11114045"
                      "Revista" => array:6 [
                        "tituloSerie" => "Radiology"
                        "fecha" => "2012"
                        "volumen" => "262"
                        "paginaInicial" => "635"
                        "paginaFinal" => "646"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22282185"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Value of the ventilation&#47;perfusion scan in acute pulmonary embolism&#46; Results of the prospective investigation of pulmonary embolism diagnosis &#40;PIOPED&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "colaboracion" => "The PIOPED Investigators"
                          "etal" => false
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Am Med Assoc"
                        "fecha" => "1990"
                        "volumen" => "263"
                        "paginaInicial" => "2753"
                        "paginaFinal" => "2759"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Gadolinium-enhanced magnetic resonance angiography for pulmonary embolism&#58; a multicenter prospective study &#40;PIOPED III&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46;D&#46; Stein"
                            1 => "T&#46;L&#46; Chenevert"
                            2 => "S&#46;E&#46; Fowler"
                            3 => "L&#46;R&#46; Goodman"
                            4 => "A&#46; Gottschalk"
                            5 => "C&#46;A&#46; Hales"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.7326/0003-4819-152-7-201004060-00008"
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Intern Med"
                        "fecha" => "2010"
                        "volumen" => "152"
                        "paginaInicial" => "434"
                        "paginaFinal" => "443"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20368649"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Acute pulmonary embolism&#58; clinical outcomes in the International Cooperative Pulmonary Embolism Registry"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "S&#46;Z&#46; Goldhaber"
                            1 => "L&#46; Visani"
                            2 => "M&#46; de Rosa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Lancet"
                        "fecha" => "1999"
                        "volumen" => "353"
                        "paginaInicial" => "24"
                        "paginaFinal" => "27"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Risk stratification of normotensive patients with acute pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "D&#46; Jim&#233;nez"
                            1 => "D&#46; Aujesky"
                            2 => "R&#46;D&#46; Yusen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-2141.2010.08406.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Br J Haematol"
                        "fecha" => "2010"
                        "volumen" => "151"
                        "paginaInicial" => "415"
                        "paginaFinal" => "424"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20955409"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Derivation and validation of a prognostic model for pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Aujesky"
                            1 => "D&#46;S&#46; Obrosky"
                            2 => "R&#46;A&#46; Stone"
                            3 => "T&#46;E&#46; Auble"
                            4 => "A&#46; Perrier"
                            5 => "J&#46; Cornuz"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1164/rccm.200506-862OC"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Respir Crit Care Med"
                        "fecha" => "2005"
                        "volumen" => "172"
                        "paginaInicial" => "1041"
                        "paginaFinal" => "1046"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16020800"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Simplification of the Pulmonary Embolism Severity Index for prognosticating patients with acute symptomatic pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Jim&#233;nez"
                            1 => "D&#46; Aujesky"
                            2 => "L&#46; Moores"
                            3 => "V&#46; G&#243;mez"
                            4 => "J&#46;L&#46; Lobo"
                            5 => "F&#46; Uresandi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1001/archinternmed.2010.199"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arch Intern Med"
                        "fecha" => "2010"
                        "volumen" => "170"
                        "paginaInicial" => "1383"
                        "paginaFinal" => "1389"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20696966"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prognostic value of right ventricular dysfunction in patients with haemodynamically stable pulmonary embolism&#58; A systematic review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "O&#46; Sanchez"
                            1 => "L&#46; Trinquart"
                            2 => "I&#46; Colombet"
                            3 => "P&#46; Durieux"
                            4 => "M&#46;V&#46; Huisman"
                            5 => "G&#46; Chatellier"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/eurheartj/ehn208"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur Heart J"
                        "fecha" => "2008"
                        "volumen" => "29"
                        "paginaInicial" => "1569"
                        "paginaFinal" => "1577"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18495689"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "CT signs of right ventricular dysfunction&#58; prognostic role in acute pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46;K&#46; Kang"
                            1 => "C&#46; Thilo"
                            2 => "J&#46; Schoepf"
                            3 => "J&#46;M&#46; Barraza"
                            4 => "J&#46;W&#46; Nance"
                            5 => "G&#46; Bastarrika"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Am Coll Cardiol Img"
                        "fecha" => "2011"
                        "volumen" => "4"
                        "paginaInicial" => "841"
                        "paginaFinal" => "849"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Multidetector computed tomography for acute pulmonary embolism&#58; diagnosis and risk stratification in a single test"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; Becattini"
                            1 => "G&#46; Agnelli"
                            2 => "M&#46;C&#46; Vedovati"
                            3 => "P&#46; Pruszczyk"
                            4 => "F&#46; Casazza"
                            5 => "S&#46; Grifoni"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/eurheartj/ehr108"
                      "Revista" => array:6 [
                        "tituloSerie" => "Eur Heart J"
                        "fecha" => "2011"
                        "volumen" => "32"
                        "paginaInicial" => "1657"
                        "paginaFinal" => "1663"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21504936"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prognostic value of troponins in acute pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "C&#46; Becattini"
                            1 => "M&#46;C&#46; Vedovati"
                            2 => "G&#46; Agnelli"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/CIRCULATIONAHA.106.680421"
                      "Revista" => array:6 [
                        "tituloSerie" => "Circulation"
                        "fecha" => "2007"
                        "volumen" => "116"
                        "paginaInicial" => "427"
                        "paginaFinal" => "433"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17606843"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Troponin-based risk stratification of patients with nonmassive pulmonary embolism&#58; systematic review and metaanalysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Jim&#233;nez"
                            1 => "F&#46; Uresandi"
                            2 => "R&#46; Otero"
                            3 => "J&#46;L&#46; Lobo"
                            4 => "M&#46; Monreal"
                            5 => "D&#46; Mart&#237;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1378/chest.09-0608"
                      "Revista" => array:6 [
                        "tituloSerie" => "Chest"
                        "fecha" => "2009"
                        "volumen" => "136"
                        "paginaInicial" => "974"
                        "paginaFinal" => "982"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19465511"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "N-terminal pro-brain natriuretic peptide or troponin testing followed by echocardiography for risk stratification of acute pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46; Binder"
                            1 => "B&#46; Pieske"
                            2 => "M&#46; Olschewski"
                            3 => "A&#46; Geibel"
                            4 => "B&#46; Klostermann"
                            5 => "C&#46; Reiner"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/CIRCULATIONAHA.105.552216"
                      "Revista" => array:6 [
                        "tituloSerie" => "Circulation"
                        "fecha" => "2005"
                        "volumen" => "112"
                        "paginaInicial" => "1573"
                        "paginaFinal" => "1579"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16144990"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Brain-type natriuretic peptide levels in the prediction of adverse outcome in patients with pulmonary embolism&#58; a systematic review and meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "F&#46;A&#46; Klok"
                            1 => "I&#46;C&#46; Mos"
                            2 => "M&#46;V&#46; Huisman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1164/rccm.200803-459OC"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Respir Crit Care Med"
                        "fecha" => "2008"
                        "volumen" => "178"
                        "paginaInicial" => "425"
                        "paginaFinal" => "430"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18556626"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prognostic significance of concomitant deep vein thrombosis in patients presenting with acute symptomatic pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Jim&#233;nez"
                            1 => "D&#46; Aujesky"
                            2 => "G&#46; D&#237;az"
                            3 => "M&#46; Monreal"
                            4 => "R&#46; Otero"
                            5 => "D&#46; Mart&#237;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1164/rccm.200908-1204OC"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Respir Crit Care Med"
                        "fecha" => "2010"
                        "volumen" => "181"
                        "paginaInicial" => "983"
                        "paginaFinal" => "991"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20110556"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Low-molecular-weight or unfractionated heparin in venous thromboembolism&#58; the influence of renal function"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Trujillo-Santos"
                            1 => "S&#46; Schellong"
                            2 => "C&#46; Falga"
                            3 => "V&#46; Zorrilla"
                            4 => "P&#46; Gallego"
                            5 => "M&#46; Barr&#243;n"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.amjmed.2012.09.021"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Med"
                        "fecha" => "2013"
                        "volumen" => "126"
                        "paginaInicial" => "425"
                        "paginaFinal" => "434"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23499331"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Low-molecular-weight heparin compared with intravenous unfractionated heparin for treatment of pulmonary embolism&#46; A meta-analysis of randomized&#44; controlled trials"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "D&#46;J&#46; Quinlan"
                            1 => "A&#46; McQuillan"
                            2 => "J&#46;W&#46; Eikelboom"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Intern Med"
                        "fecha" => "2004"
                        "volumen" => "140"
                        "paginaInicial" => "175"
                        "paginaFinal" => "183"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14757615"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Subcutaneous fondaparinux versus intravenous unfractionated heparin in the initial treatment of pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "colaboracion" => "The Matisse Investigators"
                          "etal" => false
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa035451"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2003"
                        "volumen" => "349"
                        "paginaInicial" => "1695"
                        "paginaFinal" => "1702"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14585937"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Oral rivaroxaban for symptomatic venous thromboembolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "colaboracion" => "The EINSTEIN Investigators"
                          "etal" => false
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa1007903"
                      "Revista" => array:7 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2010"
                        "volumen" => "363"
                        "paginaInicial" => "2499"
                        "paginaFinal" => "2510"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21128814"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0302283808010877"
                          "estado" => "S300"
                          "issn" => "03022838"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Oral rivaroxaban for the treatment of symptomatic pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "colaboracion" => "The EINSTEIN-PE Investigators"
                          "etal" => false
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa1113572"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2012"
                        "volumen" => "366"
                        "paginaInicial" => "1287"
                        "paginaFinal" => "1297"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22449293"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Outpatient versus inpatient treatment for patients with acute pulmonary embolism&#58; an international&#44; open-label&#44; randomised&#44; non-inferiority trial"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Aujesky"
                            1 => "P&#46;M&#46; Roy"
                            2 => "F&#46; Verschuren"
                            3 => "M&#46; Righini"
                            4 => "J&#46; Osterwalder"
                            5 => "M&#46; Egloff"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/S0140-6736(11)60824-6"
                      "Revista" => array:6 [
                        "tituloSerie" => "Lancet"
                        "fecha" => "2011"
                        "volumen" => "378"
                        "paginaInicial" => "41"
                        "paginaFinal" => "48"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21703676"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Oral apixaban for the treatment of acute venous thromboembolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46; Agnelli"
                            1 => "H&#46;R&#46; B&#252;ller"
                            2 => "A&#46; Cohen"
                            3 => "M&#46; Curto"
                            4 => "A&#46;S&#46; Gallus"
                            5 => "M&#46; Johnson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa1302507"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2013"
                        "volumen" => "369"
                        "paginaInicial" => "799"
                        "paginaFinal" => "808"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23808982"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Ambulation after deep vein thrombosis&#58; a systematic review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "C&#46;M&#46; Anderson"
                            1 => "T&#46;J&#46; Overend"
                            2 => "J&#46; Godwin"
                            3 => "C&#46; Sealy"
                            4 => "A&#46; Sunderji"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3138/physio.61.3.133"
                      "Revista" => array:6 [
                        "tituloSerie" => "Physiother Can"
                        "fecha" => "2009"
                        "volumen" => "61"
                        "paginaInicial" => "133"
                        "paginaFinal" => "140"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20514175"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Combinations of prognostic tools for identification of high-risk normotensive patients with acute symptomatic pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Jim&#233;nez"
                            1 => "D&#46; Aujesky"
                            2 => "L&#46; Moores"
                            3 => "V&#46; G&#243;mez"
                            4 => "D&#46; Mart&#237;"
                            5 => "S&#46; Briongos"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/thx.2010.150656"
                      "Revista" => array:6 [
                        "tituloSerie" => "Thorax"
                        "fecha" => "2011"
                        "volumen" => "66"
                        "paginaInicial" => "75"
                        "paginaFinal" => "81"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20978032"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:1 [
                      "titulo" => "The Urokinase Pulmonary Embolism Trial&#58; a national cooperative study"
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Circulation"
                        "fecha" => "1973"
                        "volumen" => "47"
                        "numero" => "Suppl"
                        "paginaInicial" => "II1"
                        "paginaFinal" => "II108"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/4266893"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Management of massive and submassive pulmonary embolism&#44; iliofemoral deep vein thrombosis&#44; and chronic thromboembolic pulmonary hypertension&#58; a scientific statement from the American Heart Association"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;R&#46; Jaff"
                            1 => "S&#46;L&#46; Archer"
                            2 => "M&#46; Cushman"
                            3 => "N&#46; Goldenberg"
                            4 => "S&#46;Z&#46; Goldhaber"
                            5 => "S&#46; Jenkins"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/CIR.0b013e318214914f"
                      "Revista" => array:6 [
                        "tituloSerie" => "Circulation"
                        "fecha" => "2011"
                        "volumen" => "123"
                        "paginaInicial" => "1788"
                        "paginaFinal" => "1830"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21422387"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Heparin plus alteplase compared with heparin alone in patients with submassive pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:3 [
                          "colaboracion" => "Management Strategies and Prognosis of Pulmonary Embolism-3 Trial Investigators"
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46; Konstantinides"
                            1 => "A&#46; Geibel"
                            2 => "G&#46; Heusel"
                            3 => "F&#46; Heinrich"
                            4 => "W&#46; Kasper"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa021274"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2002"
                        "volumen" => "347"
                        "paginaInicial" => "1143"
                        "paginaFinal" => "1150"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12374874"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Single-bolus tenecteplase plus heparin compared with heparin alone for normotensive patients with acute pulmonary embolism&#44; who have evidence of right ventricular dysfunction and myocardial injury&#58; rationale and design of the pulmonary embolism thrombolysis &#40;PEITHO&#41; trial"
                      "autores" => array:1 [
                        0 => array:2 [
                          "colaboracion" => "The Steering Committe&#44; on behalf of the PEITHO investigators"
                          "etal" => false
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ahj.2011.10.003"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am Heart J"
                        "fecha" => "2012"
                        "volumen" => "163"
                        "paginaInicial" => "33"
                        "paginaFinal" => "38"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22172434"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0185"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A clinical trial of vena cava filters in the prevention of pulmonary embolism in patients with proximal deep vein thrombosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46; Decousus"
                            1 => "A&#46; Leizorovicz"
                            2 => "F&#46; Parent"
                            3 => "Y&#46; Page"
                            4 => "B&#46; Tardy"
                            5 => "P&#46; Girard"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJM199802123380701"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "1998"
                        "volumen" => "338"
                        "paginaInicial" => "409"
                        "paginaFinal" => "415"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9459643"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Management of unsuccessful thrombolysis in acute massive pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "N&#46; Meneveau"
                            1 => "M&#46;F&#46; S&#233;ronde"
                            2 => "M&#46;C&#46; Blonde"
                            3 => "P&#46; Legalery"
                            4 => "K&#46; Didier-Petit"
                            5 => "F&#46; Briand"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1378/chest.129.4.1043"
                      "Revista" => array:6 [
                        "tituloSerie" => "Chest"
                        "fecha" => "2006"
                        "volumen" => "129"
                        "paginaInicial" => "1043"
                        "paginaFinal" => "1050"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16608956"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Subsegmental pulmonary embolism diagnosed by computed tomography&#58; incidence and clinical implications&#46; A systematic review and meta-analysis of the management outcome studies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Carrier"
                            1 => "M&#46; Righini"
                            2 => "P&#46;S&#46; Wells"
                            3 => "A&#46; Perrier"
                            4 => "D&#46;R&#46; Anderson"
                            5 => "M&#46;A&#46; Rodger"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1538-7836.2010.03938.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Thromb Haemost"
                        "fecha" => "2010"
                        "volumen" => "8"
                        "paginaInicial" => "1716"
                        "paginaFinal" => "1722"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20546118"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            39 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "40"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Unsuspected pulmonary emboli adversely impact survival in patients with cancer undergoing routine staging multi-row detector computed tomography scanning"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; O&#8217;Connell"
                            1 => "P&#46; Razavi"
                            2 => "M&#46; Ghalichi"
                            3 => "S&#46; Boyle"
                            4 => "S&#46; Vasan"
                            5 => "L&#46; Mark"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1538-7836.2010.04114.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Thromb Haemost"
                        "fecha" => "2011"
                        "volumen" => "9"
                        "paginaInicial" => "305"
                        "paginaFinal" => "311"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20955348"
                             …1
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            40 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "41"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Influence of preceding length of anticoagulant treatment and initial presentation of venous thromboembolism on risk of recurrence after stopping treatment&#58; analysis of individual participants&#8217; data from seven trials"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Br Med J"
                        "fecha" => "2011"
                        "volumen" => "342"
                        "paginaInicial" => "d3036"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            41 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "42"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Risk of recurrence after a first episode of symptomatic venous thromboembolism provoked by a transient risk factor&#58; a systematic review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1001/archinternmed.2010.367"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arch Intern Med"
                        "fecha" => "2010"
                        "volumen" => "170"
                        "paginaInicial" => "1710"
                        "paginaFinal" => "1716"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            42 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "43"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Predictive variables for major bleeding events in patients presenting with documented acute venous thromboembolism&#46; Findings from the RIETE Registry"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1160/TH08-03-0193"
                      "Revista" => array:6 [
                        "tituloSerie" => "Thromb Haemost"
                        "fecha" => "2008"
                        "volumen" => "100"
                        "paginaInicial" => "26"
                        "paginaFinal" => "31"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            43 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "44"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Does the clinical presentation and extent of venous thrombosis predict likelihood and type of recurrence&#63; A patient-level meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1538-7836.2010.04022.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Thromb Haemost"
                        "fecha" => "2010"
                        "volumen" => "8"
                        "paginaInicial" => "2436"
                        "paginaFinal" => "2442"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            44 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "45"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "D-dimer testing to determine the duration of anticoagulation therapy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa054444"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2006"
                        "volumen" => "355"
                        "paginaInicial" => "1780"
                        "paginaFinal" => "1789"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            45 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "46"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Residual vein obstruction to predict the risk of recurrent venous thromboembolism in patients with deep vein thrombosis&#58; a systematic review and meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [ …5]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1538-7836.2011.04254.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Thromb Haemost"
                        "fecha" => "2011"
                        "volumen" => "9"
                        "paginaInicial" => "1119"
                        "paginaFinal" => "1125"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            46 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "47"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Comparison of outcomes after hospitalization for deep venous thrombosis or pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [ …3]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Thromb Haemost"
                        "fecha" => "2002"
                        "volumen" => "88"
                        "paginaInicial" => "407"
                        "paginaFinal" => "414"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            47 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "48"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Risk of recurrent venous thromboembolism in patients with common thrombophilia&#58; a systematic review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [ …4]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1001/archinte.166.7.729"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arch Intern Med"
                        "fecha" => "2006"
                        "volumen" => "166"
                        "paginaInicial" => "729"
                        "paginaFinal" => "736"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            48 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "49"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Predicting disease recurrence in patients with previous unprovoked venous thromboembolism&#46; A proposed prediction score &#40;DASH&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1538-7836.2012.04735.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Thromb Haemost"
                        "fecha" => "2012"
                        "volumen" => "10"
                        "paginaInicial" => "1019"
                        "paginaFinal" => "1025"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            49 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "50"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Risk assessment of recurrence in patients with unprovoked deep vein thrombosis or pulmonary embolism&#58; the Vienna prediction model"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [ …4]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1161/CIRCULATIONAHA.109.925214"
                      "Revista" => array:6 [
                        "tituloSerie" => "Circulation"
                        "fecha" => "2010"
                        "volumen" => "121"
                        "paginaInicial" => "1630"
                        "paginaFinal" => "1636"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            50 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "51"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identifying unprovoked thromboembolism patients at low risk for recurrence who can discontinue anticoagulant therapy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Can Med Assoc J"
                        "fecha" => "2008"
                        "volumen" => "179"
                        "paginaInicial" => "417"
                        "paginaFinal" => "426"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            51 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "52"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Comparison of low-intensity warfarin therapy with conventional-intensity warfarin therapy for long-term prevention of recurrent venous thromboembolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa035422"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2003"
                        "volumen" => "349"
                        "paginaInicial" => "631"
                        "paginaFinal" => "639"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            52 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "53"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Long-term&#44; low-intensity warfarin therapy for the prevention recurrent venous thromboembolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa035029"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2003"
                        "volumen" => "348"
                        "paginaInicial" => "1425"
                        "paginaFinal" => "1434"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            53 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "54"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Apixaban for extended treatment of venous thromboembolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa1207541"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2013"
                        "volumen" => "368"
                        "paginaInicial" => "699"
                        "paginaFinal" => "708"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            54 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "55"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Extended use of dabigatran&#44; warfarin&#44; or placebo in venous thromboembolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa1113697"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2013"
                        "volumen" => "368"
                        "paginaInicial" => "709"
                        "paginaFinal" => "718"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            55 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "56"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Aspirin for preventing the recurrence of venous thromboembolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa1114238"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2012"
                        "volumen" => "366"
                        "paginaInicial" => "1959"
                        "paginaFinal" => "1967"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            56 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "57"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Low-dose aspirin for preventing recurrent venous thromboembolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa1210384"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2012"
                        "volumen" => "367"
                        "paginaInicial" => "1979"
                        "paginaFinal" => "1987"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            57 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "58"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Resolution of thromboemboli in patients with acute pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [ …4]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1378/chest.129.1.192"
                      "Revista" => array:6 [
                        "tituloSerie" => "Chest"
                        "fecha" => "2006"
                        "volumen" => "129"
                        "paginaInicial" => "192"
                        "paginaFinal" => "197"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            58 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "59"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The natural course of hemodynamically stable pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1378/chest.05-2799"
                      "Revista" => array:6 [
                        "tituloSerie" => "Chest"
                        "fecha" => "2007"
                        "volumen" => "131"
                        "paginaInicial" => "517"
                        "paginaFinal" => "523"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            59 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "60"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Incidence of chronic thromboembolic pulmonary hypertension after pulmonary embolism"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJMoa032274"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med"
                        "fecha" => "2004"
                        "volumen" => "350"
                        "paginaInicial" => "2257"
                        "paginaFinal" => "2264"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            60 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "61"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Chronic thromboembolic pulmonary hypertension&#46; Risk factors"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [ …3]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Arch Bronconeumol"
                        "fecha" => "2009"
                        "volumen" => "45"
                        "paginaInicial" => "10"
                        "paginaFinal" => "13"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            61 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "62"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Is extensive screening for cancer in idiopathic venous thromboembolism warranted&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [ …6]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1538-7836.2010.04101.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Thromb Haemost"
                        "fecha" => "2011"
                        "volumen" => "9"
                        "paginaInicial" => "79"
                        "paginaFinal" => "84"
                        "link" => array:1 [
                          0 => array:2 [ …2]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001900/v1_201312010030/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "9379"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Recommendations of SEPAR"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/15792129/0000004900000012/v1_201312010030/S1579212913001900/v1_201312010030/en/main.pdf?idApp=UINPBA00003Z&text.app=https://archbronconeumol.org/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001900?idApp=UINPBA00003Z"
]

Article information

ISSN: 15792129
Original language: English

DOI:10.1016/j.arbr.2013.10.008

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	7	4	11
2024 October	73	35	108
2024 September	64	30	94
2024 August	86	62	148
2024 July	69	25	94
2024 June	81	29	110
2024 May	152	53	205
2024 April	69	48	117
2024 March	62	26	88
2024 February	47	43	90
2023 November	1	0	1
2023 October	1	2	3
2023 July	13	0	13
2023 March	18	3	21
2023 February	103	20	123
2023 January	65	51	116
2022 December	121	35	156
2022 November	122	39	161
2022 October	71	36	107
2022 September	65	40	105
2022 August	85	40	125
2022 July	65	54	119
2022 June	85	47	132
2022 May	103	33	136
2022 April	93	40	133
2022 March	107	57	164
2022 February	122	31	153
2022 January	150	44	194
2021 December	167	39	206
2021 November	152	48	200
2021 October	137	50	187
2021 September	110	51	161
2021 August	122	53	175
2021 July	140	36	176
2021 June	123	41	164
2021 May	119	62	181
2021 April	304	80	384
2021 March	249	40	289
2021 February	137	38	175
2021 January	128	21	149
2020 December	94	32	126
2020 November	109	18	127
2020 October	101	15	116
2020 September	74	20	94
2020 August	75	13	88
2020 July	100	33	133
2020 June	86	15	101
2020 May	103	27	130
2020 April	114	19	133
2020 March	97	29	126
2020 February	97	17	114
2020 January	133	25	158
2019 December	169	37	206
2019 November	132	28	160
2019 October	63	24	87
2019 September	84	28	112
2019 August	86	21	107
2019 July	72	25	97
2019 June	82	15	97
2019 May	180	20	200
2019 April	122	24	146
2019 March	97	23	120
2019 February	96	35	131
2019 January	64	28	92
2018 December	73	25	98
2018 November	126	42	168
2018 October	106	58	164
2018 September	74	21	95
2018 May	107	0	107
2018 April	148	5	153
2018 March	116	10	126
2018 February	103	9	112
2018 January	136	7	143
2017 December	120	7	127
2017 November	80	16	96
2017 October	82	9	91
2017 September	107	67	174
2017 August	107	54	161
2017 July	101	41	142
2017 June	131	41	172
2017 May	139	47	186
2017 April	128	63	191
2017 March	121	104	225
2017 February	93	54	147
2017 January	84	51	135
2016 December	129	55	184
2016 November	220	68	288
2016 October	220	57	277
2016 September	291	46	337
2016 August	246	25	271
2016 July	112	34	146
2016 June	1	0	1
2016 March	3	0	3
2016 February	1	0	1
2016 January	2	0	2
2015 December	4	0	4
2015 October	149	4	153
2015 September	162	41	203
2015 August	145	27	172
2015 July	199	26	225
2015 June	174	33	207
2015 May	146	43	189
2015 April	148	35	183
2015 March	211	32	243
2015 February	179	27	206
2015 January	88	38	126
2014 December	98	46	144
2014 November	116	24	140
2014 October	134	40	174
2014 September	122	50	172
2014 August	85	13	98
2014 July	92	21	113
2014 June	99	24	123
2014 May	113	24	137
2014 April	116	32	148
2014 March	84	42	126
2014 February	3	0	3
2014 January	5	9	14
2013 December	8	5	13

Show all

Indexed in:

Follow us:

Subscribe:

Statistics

Indexed in:

Follow us:

Subscribe:

Statistics

Subscribe to our newsletter