Nota clínica
Déficit de alfa-1-antitripsina asociado a la variante Matawa
Alpha-1-Antitrypsin Deficiency Associated With the Mattawa Variant
Beatriz Laraa,
, Beatriz Martínez-Delgadob, Maria Luisa Torresc, Sandra Marín-Arguedasd, Ana Bustamantee, Marc Miravitllesf
Corresponding author
a Servicio de Neumología, Hospital Universitario Arnau de Vilanova, Lleida, España
b Unidad de Genética Molecular, Área de Genética Humana, Instituto de Investigación en Enfermedades Raras, Instituto de Salud Carlos III, Madrid, España
c Servicio de Neumología, Complexo Hospitalario Universitario de Vigo, Vigo, Pontevedra, España
d Servicio de Neumología, Hospital Dos de Maig, Barcelona, España
e Servicio de Neumología, Hospital de Sierrallana, Torrelavega, Cantabria, España
f Servicio de Neumología, Hospital Universitario Vall d’Hebron, Barcelona, España
Read
10433
Timeswas read the article
2223
Total PDF
8210
Total HTML
Share statistics
array:24 [ "pii" => "S030028961300152X" "issn" => "03002896" "doi" => "10.1016/j.arbres.2013.05.004" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "784" "copyright" => "SEPAR" "copyrightAnyo" => "2013" "documento" => "article" "crossmark" => 0 "subdocumento" => "sco" "cita" => "Arch Bronconeumol. 2013;49:548-50" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 5983 "formatos" => array:3 [ "EPUB" => 100 "HTML" => 5217 "PDF" => 666 ] ] "Traduccion" => array:1 [ "en" => array:19 [ "pii" => "S1579212913001924" "issn" => "15792129" "doi" => "10.1016/j.arbr.2013.10.010" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "784" "copyright" => "SEPAR" "documento" => "simple-article" "crossmark" => 0 "subdocumento" => "crp" "cita" => "Arch Bronconeumol. 2013;49:548-50" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:2 [ "total" => 4405 "formatos" => array:3 [ "EPUB" => 120 "HTML" => 3201 "PDF" => 1084 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Case report</span>" "titulo" => "Alpha-1-Antitrypsin Deficiency Associated With the Mattawa Variant" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "548" "paginaFinal" => "550" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Déficit de alfa-1-antitripsina asociado a la variante Matawa" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1104 "Ancho" => 2599 "Tamanyo" => 274980 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Sequence corresponding to exon 5 SERPINA1. (A) Normal sequence. (B) Sequence corresponding to the patient, which shows insertion of a thymine (T) instead of an adenine (A) at codon 376 in exon 5 of heterozygosity for the PI-Mattawa allele. The SERPINA1 gene coding sequence (exons 2–5) was analyzed using previously described primers for exons 3–5 and 5′ACGTGGTGTCAATCCCTGATCACTG3′ Ex2F primers and ex2R 5′TATGGGAACAGCTGG3′ for exon 2, with reference to the comparative SERPINA1_Transcript_ENST00000440909.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Beatriz Lara, Beatriz Martínez-Delgado, Maria Luisa Torres, Sandra Marín-Arguedas, Ana Bustamante, Marc Miravitlles" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Beatriz" "apellidos" => "Lara" ] 1 => array:2 [ "nombre" => "Beatriz" "apellidos" => "Martínez-Delgado" ] 2 => array:2 [ "nombre" => "Maria Luisa" "apellidos" => "Torres" ] 3 => array:2 [ "nombre" => "Sandra" "apellidos" => "Marín-Arguedas" ] 4 => array:2 [ "nombre" => "Ana" "apellidos" => "Bustamante" ] 5 => array:2 [ "nombre" => "Marc" "apellidos" => "Miravitlles" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S030028961300152X" "doi" => "10.1016/j.arbres.2013.05.004" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S030028961300152X?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001924?idApp=UINPBA00003Z" "url" => "/15792129/0000004900000012/v1_201312010030/S1579212913001924/v1_201312010030/en/main.assets" ] ] "itemSiguiente" => array:19 [ "pii" => "S0300289613002378" "issn" => "03002896" "doi" => "10.1016/j.arbres.2013.07.016" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "818" "copyright" => "SEPAR" "documento" => "article" "crossmark" => 0 "subdocumento" => "sco" "cita" => "Arch Bronconeumol. 2013;49:551-2" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 5799 "formatos" => array:3 [ "EPUB" => 127 "HTML" => 5064 "PDF" => 608 ] ] "es" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Imagen clínica</span>" "titulo" => "Aneurisma de la arteria pulmonar" "tienePdf" => "es" "tieneTextoCompleto" => "es" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "551" "paginaFinal" => "552" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Pulmonary Artery Aneurysm" ] ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 573 "Ancho" => 2600 "Tamanyo" => 183554 ] ] "descripcion" => array:1 [ "es" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Rx tórax PA (A) y lateral (B) en la que se visualiza lesión redondeada de perfiles lisos localizada a nivel del hilio izquierdo en la proyección PA (flechas 1A), que se proyecta al espacio retroesternal (flecha 1B). La TC torácica con la administración de CIV, proyección sagital y axial (C-D) confirma la dilatación aneurismática del cono de la arteria pulmonar.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Victoria Mayoral-Campos, José Luis de Benito-Arévalo, Marzo Antonio Varea-Sanz" "autores" => array:3 [ 0 => array:2 [ "nombre" => "Victoria" "apellidos" => "Mayoral-Campos" ] 1 => array:2 [ "nombre" => "José Luis" "apellidos" => "de Benito-Arévalo" ] 2 => array:2 [ "nombre" => "Marzo Antonio" "apellidos" => "Varea-Sanz" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S1579212913001882" "doi" => "10.1016/j.arbr.2013.10.006" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001882?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289613002378?idApp=UINPBA00003Z" "url" => "/03002896/0000004900000012/v1_201312040037/S0300289613002378/v1_201312040037/es/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S0300289613002263" "issn" => "03002896" "doi" => "10.1016/j.arbres.2013.07.008" "estado" => "S300" "fechaPublicacion" => "2013-12-01" "aid" => "808" "copyright" => "SEPAR" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Arch Bronconeumol. 2013;49:534-47" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 138621 "formatos" => array:3 [ "EPUB" => 171 "HTML" => 123289 "PDF" => 15161 ] ] "es" => array:11 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Normativa SEPAR</span>" "titulo" => "Consenso nacional sobre el diagnóstico, estratificación de riesgo y tratamiento de los pacientes con tromboembolia pulmonar" "tienePdf" => "es" "tieneTextoCompleto" => "es" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "534" "paginaFinal" => "547" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "National Consensus on the Diagnosis, Risk Stratification and Treatment of Patients with Pulmonary Embolism" ] ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figura 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 2263 "Ancho" => 3137 "Tamanyo" => 361981 ] ] "descripcion" => array:1 [ "es" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Estratificación pronóstica y tratamiento de la tromboembolia pulmonar en fase aguda. BNP: péptido natriurético cerebral; DVD: disfunción ventricular derecha; Fx: fondaparinux; HBPM: heparina de bajo peso molecular; HFABP: proteína ligadora de ácidos grasos cardiacos; HNF: heparina no fraccionada; hsTnT: troponina T de alta sensibilidad; PESI: Pulmonary Embolism Severity Index; PESIs: PESI simplificada; TVP: trombosis venosa profunda; UCI: unidad de cuidados intensivos.*Shock cardiogénico o presión arterial sistólica<span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>90<span class="elsevierStyleHsp" style=""></span>mm Hg mantenida, no debida a hipovolemia, sepsis o arritmias cardiacas.</p> <p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">La línea discontinua indica ausencia de evidencia definitiva (fibrinólisis) o de experiencia clínica amplia (rivaroxaban).</p> <p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Para aquellas situaciones no contempladas en el algoritmo, se recomienda hospitalización y tratamiento anticoagulante convencional.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Fernando Uresandi, Manuel Monreal, Ferrán García-Bragado, Pere Domenech, Ramón Lecumberri, Pilar Escribano, José Luis Zamorano, Sonia Jiménez, Pedro Ruiz-Artacho, Francisco Lozano, Antonio Romera, David Jiménez" "autores" => array:13 [ 0 => array:2 [ "nombre" => "Fernando" "apellidos" => "Uresandi" ] 1 => array:2 [ "nombre" => "Manuel" "apellidos" => "Monreal" ] 2 => array:2 [ "nombre" => "Ferrán" "apellidos" => "García-Bragado" ] 3 => array:2 [ "nombre" => "Pere" "apellidos" => "Domenech" ] 4 => array:2 [ "nombre" => "Ramón" "apellidos" => "Lecumberri" ] 5 => array:2 [ "nombre" => "Pilar" "apellidos" => "Escribano" ] 6 => array:2 [ "nombre" => "José Luis" "apellidos" => "Zamorano" ] 7 => array:2 [ "nombre" => "Sonia" "apellidos" => "Jiménez" ] 8 => array:2 [ "nombre" => "Pedro" "apellidos" => "Ruiz-Artacho" ] 9 => array:2 [ "nombre" => "Francisco" "apellidos" => "Lozano" ] 10 => array:2 [ "nombre" => "Antonio" "apellidos" => "Romera" ] 11 => array:2 [ "nombre" => "David" "apellidos" => "Jiménez" ] 12 => array:1 [ "colaborador" => "en representación del Consenso nacional sobre el diagnóstico, estratificación de riesgo y tratamiento de los pacientes con tromboembolia pulmonar" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S1579212913001900" "doi" => "10.1016/j.arbr.2013.10.008" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => false "ES2" => false "LATM" => false ] "gratuito" => false "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1579212913001900?idApp=UINPBA00003Z" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0300289613002263?idApp=UINPBA00003Z" "url" => "/03002896/0000004900000012/v1_201312040037/S0300289613002263/v1_201312040037/es/main.assets" ] "es" => array:20 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Nota clínica</span>" "titulo" => "Déficit de alfa-1-antitripsina asociado a la variante Matawa" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "548" "paginaFinal" => "550" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Beatriz Lara, Beatriz Martínez-Delgado, Maria Luisa Torres, Sandra Marín-Arguedas, Ana Bustamante, Marc Miravitlles" "autores" => array:6 [ 0 => array:4 [ "nombre" => "Beatriz" "apellidos" => "Lara" "email" => array:1 [ 0 => "beat1135@gmail.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">¿</span>" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "Beatriz" "apellidos" => "Martínez-Delgado" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "Maria Luisa" "apellidos" => "Torres" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 3 => array:3 [ "nombre" => "Sandra" "apellidos" => "Marín-Arguedas" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff0020" ] ] ] 4 => array:3 [ "nombre" => "Ana" "apellidos" => "Bustamante" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">e</span>" "identificador" => "aff0025" ] ] ] 5 => array:3 [ "nombre" => "Marc" "apellidos" => "Miravitlles" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">f</span>" "identificador" => "aff0030" ] ] ] ] "afiliaciones" => array:6 [ 0 => array:3 [ "entidad" => "Servicio de Neumología, Hospital Universitario Arnau de Vilanova, Lleida, España" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Unidad de Genética Molecular, Área de Genética Humana, Instituto de Investigación en Enfermedades Raras, Instituto de Salud Carlos III, Madrid, España" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Servicio de Neumología, Complexo Hospitalario Universitario de Vigo, Vigo, Pontevedra, España" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Servicio de Neumología, Hospital Dos de Maig, Barcelona, España" "etiqueta" => "d" "identificador" => "aff0020" ] 4 => array:3 [ "entidad" => "Servicio de Neumología, Hospital de Sierrallana, Torrelavega, Cantabria, España" "etiqueta" => "e" "identificador" => "aff0025" ] 5 => array:3 [ "entidad" => "Servicio de Neumología, Hospital Universitario Vall d’Hebron, Barcelona, España" "etiqueta" => "f" "identificador" => "aff0030" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Autor para correspondencia." ] ] ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Alpha-1-Antitrypsin Deficiency Associated With the Mattawa Variant" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1103 "Ancho" => 2596 "Tamanyo" => 243756 ] ] "descripcion" => array:1 [ "es" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Secuencia correspondiente al exón 5 del gen SERPINA1. A)<span class="elsevierStyleHsp" style=""></span>Secuencia normal. B)<span class="elsevierStyleHsp" style=""></span>Secuencia correspondiente a la paciente, donde se ve la inserción de una timina (T) en vez de una adenina (A) en el codón 376 del exón 5 en heterocigosis, correspondiente al alelo PI-Mattawa. La secuencia codificante del gen SERPINA1 (exones 2 a 5) se analizó utilizando <span class="elsevierStyleItalic">primers</span> previamente descritos para los exones 3 a 5 y <span class="elsevierStyleItalic">primers</span> ex2F 5′ACGTGGTGTCAATCCCTGATCACTG3′ y ex2R 5′TATGGGAACAGCTGG3′ para el exón 2, tomando como referencia comparativa la SERPINA1_Transcript_ENST00000440909.</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Introducción</span><p id="par0005" class="elsevierStylePara elsevierViewall">Los alelos normales de alfa-1-antitripsina (AAT), presentes en el 85-90% de los individuos, se denominan M, y los deficientes más frecuentes, S y Z (frecuencias respectivas: 10 y 1,7% de la población española)<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a>. Los alelos M, S y Z expresan respectivamente alrededor del 100, del 40 y del 15% de AAT sérica<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a>.</p><p id="par0010" class="elsevierStylePara elsevierViewall">El déficit grave de AAT, definido por niveles séricos por debajo del 35% del valor medio esperado, es una condición rara, generalmente asociada a homocigotos PI*ZZ y con mucha menor frecuencia a combinaciones de alelos Z, S, raros y nulos. Sin embargo, en los últimos años el laboratorio del Registro Español de Pacientes con Déficit de AAT (REDAAT) ha detectado un 1,6% de alelos raros y nulos<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">3</span></a> (tasa comparable a la encontrada en Italia, Suiza, Alemania y Estados Unidos)<a class="elsevierStyleCrossRefs" href="#bib0020"><span class="elsevierStyleSup">4,5</span></a>, la mayoría Mmalton, pero también Mheerlen, NullClayton, NullBellingham, Mvhebron, Ybarcelona<a class="elsevierStyleCrossRefs" href="#bib0030"><span class="elsevierStyleSup">6-8</span></a>, etc.</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Observación clínica</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Caso 1</span><p id="par0015" class="elsevierStylePara elsevierViewall">Mujer de 47<span class="elsevierStyleHsp" style=""></span>años no fumadora, con hipertensión arterial esencial, bronquitis de repetición desde los 25<span class="elsevierStyleHsp" style=""></span>años y disnea de esfuerzo en los 3 últimos años.</p><p id="par0020" class="elsevierStylePara elsevierViewall">Su espirometría fue normal (FVC 96%, FEV1 105%, FEV<span class="elsevierStyleInf">1</span>/FVC 84), pero su capacidad de difusión, DLCO y KCO, fueron del 68 y del 61% de sus valores teóricos respectivos. La TAC torácica presentó acentuación del patrón bronquial sin signos de bronquiectasias ni de enfisema. La función hepática fue normal. La concentración de AAT en suero fue de 73,7<span class="elsevierStyleHsp" style=""></span>mg/dl (referencia: 103-200), compatible con un déficit parcial de AAT, y el fenotipo etiquetado como Pi MM, no concordante con las concentraciones de AAT, por lo que se realizó una secuenciación del gen de la AAT en sangre periférica que detectó una mutación PI Null Mattawa, caracterizada por la inserción de un nucleótido dentro de la región codificadora del exón<span class="elsevierStyleHsp" style=""></span>5, que desplaza el marco de lectura <span class="elsevierStyleItalic">(frameshift mutation)</span> a la posición 376, lo que genera una señal de stop prematura, que finalmente traduce una proteína truncada, muy inestable, que se degrada dentro del hepatocito y resulta indetectable en suero<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a> (<a class="elsevierStyleCrossRef" href="#fig0005">fig. 1</a>).</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0025" class="elsevierStylePara elsevierViewall">La paciente tenía además otra variante normal en el exón<span class="elsevierStyleHsp" style=""></span>5, consistente en un cambio de adenina (A) por citosina (C) en el nucleótido 1200 del cDNA, que genera un cambio de aminoácido glutámico (Glu) por aspártico (Asp) en el codón<span class="elsevierStyleHsp" style=""></span>400 (c.1200A<span class="elsevierStyleHsp" style=""></span>><span class="elsevierStyleHsp" style=""></span>C/p.Glu400Asp), que se correspondía con un alelo M<span class="elsevierStyleInf">3</span>. Por tanto, se trata de un genotipo heterocigoto PI*M<span class="elsevierStyleInf">3</span>-Null Mattawa, con niveles séricos de AAT moderadamente reducidos.</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Caso 2</span><p id="par0030" class="elsevierStylePara elsevierViewall">A partir de la base de datos del REDAAT<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a> se localizó otra persona portadora del alelo Null Matawa.</p><p id="par0035" class="elsevierStylePara elsevierViewall">Mujer de 67<span class="elsevierStyleHsp" style=""></span>años con antecedentes de tuberculosis pleuropulmonar con curación bacteriológica documentada. Frecuentes episodios de infecciones respiratorias. Parámetros funcionales compatibles con una obstrucción al flujo aéreo grave (FEV<span class="elsevierStyleInf">1</span>: 620<span class="elsevierStyleHsp" style=""></span>ml [22% del valor teórico], FVC: 1.280<span class="elsevierStyleHsp" style=""></span>ml [39% del valor teórico]). Un TAC de alta resolución mostró enfisema centrolobulillar y paraseptal difuso y bronquiectasias cilíndricas difusas. Nunca se detectaron datos de afectación hepática.</p><p id="par0040" class="elsevierStylePara elsevierViewall">Sus concentraciones de AAT en suero eran de 43<span class="elsevierStyleHsp" style=""></span>mg/dl. El IEE sugirió un fenotipo Pi MM, pero al no corresponderse con la concentración sérica de AAT se realizó un estudio genético, que detectó un alelo PI*Mmalton (deleción del residuo 52)<a class="elsevierStyleCrossRef" href="#bib0055"><span class="elsevierStyleSup">11</span></a> y un PI*Null Mattawa, cuya combinación justificó las bajas concentraciones séricas de AAT de la paciente.</p></span></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Discusión</span><p id="par0045" class="elsevierStylePara elsevierViewall">La excepcionalidad de los alelos nulos (prevalencia estimada 100-200 veces inferior que los Z) impide el conocimiento preciso de su impacto clínico y de su verdadera prevalencia. Sin embargo, es importante tenerlos en cuenta, ya que pueden generar confusiones diagnósticas si no se realizan estudios genómicos.</p><p id="par0050" class="elsevierStylePara elsevierViewall">El alelo Mmalton (también denominado Mcagliari y Mnichinan) fue descrito por primera vez en 1987 y, al igual que el gen Z, produce una proteína mal plegada, de la que un 80-90% polimeriza en el hepatocito sin ser secretada a sangre, donde expresa niveles inferiores al 15%, y se asocia con alto riesgo de enfisema pulmonar y de hepatopatía<a class="elsevierStyleCrossRefs" href="#bib0055"><span class="elsevierStyleSup">11,12</span></a><span class="elsevierStyleSup">,</span>.</p><p id="par0055" class="elsevierStylePara elsevierViewall">El alelo Mattawa (y en general cualquier alelo nulo) se caracteriza por codificar proteínas con importantes cambios conformacionales, que son degradadas a nivel intracelular sin llegar a polimerizar, y expresan concentraciones indetectables de AAT sérica. Esto hace que los homocigotos conlleven un riesgo muy alto de enfisema, pero no de hepatopatía.</p><p id="par0060" class="elsevierStylePara elsevierViewall">En conclusión, en nuestras pacientes la discordancia entre el fenotipo y las concentraciones séricas de AAT hizo sospechar la existencia de alelos infrecuente, y fue finalmente el análisis molecular del gen el que proporcionó el diagnóstico correcto, tal como se recoge en las recomendaciones<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a>.</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conflicto de intereses</span><p id="par0065" class="elsevierStylePara elsevierViewall">Los autores declaran no tener ningún conflicto de intereses.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:9 [ 0 => array:2 [ "identificador" => "xres296406" "titulo" => "Resumen" ] 1 => array:2 [ "identificador" => "xpalclavsec280022" "titulo" => "Palabras clave" ] 2 => array:2 [ "identificador" => "xres296407" "titulo" => "Abstract" ] 3 => array:2 [ "identificador" => "xpalclavsec280021" "titulo" => "Keywords" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introducción" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Observación clínica" "secciones" => array:2 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Caso 1" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Caso 2" ] ] ] 6 => array:2 [ "identificador" => "sec0025" "titulo" => "Discusión" ] 7 => array:2 [ "identificador" => "sec0030" "titulo" => "Conflicto de intereses" ] 8 => array:1 [ "titulo" => "Bibliografía" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2013-04-04" "fechaAceptado" => "2013-05-09" "PalabrasClave" => array:2 [ "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec280022" "palabras" => array:3 [ 0 => "Déficit de alfa-1-antitripsina" 1 => "Mattawa" 2 => "Registro Español de pacientes con déficit de alfa-1-antitripsina" ] ] ] "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec280021" "palabras" => array:3 [ 0 => "Alpha-1-antitrypsin deficiency" 1 => "Mattawa" 2 => "Spanish Registry of patients with alpha-1-antitrypsin deficiency" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "es" => array:2 [ "titulo" => "Resumen" "resumen" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Los alelos deficitarios más frecuentes son los Pi*S y Pi*Z, pero existen también otras variantes deficientes.</p><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">En la presente nota clínica se describen los 2 primeros casos detectados en España de déficit de alfa-1-antitripsina (DAAT), resultante de la combinación de un alelo nulo Mattawa con un normal PI*M y con un raro Mmalton.</p><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Ambos casos fueron inicialmente diagnosticados como Pi*MM por isoelectroenfoque (IEE), pero los valores séricos bajos de AAT hicieron sospechar la existencia de alelos deficientes infrecuentes indetectables por IEE, por lo que se realizó un análisis molecular del gen que proporcionó el diagnóstico correcto.</p><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Las incoherencias entre los valores séricos de AAT y el fenotipo deben hacer sospechar la existencia de uno de estos alelos infrecuentes.</p>" ] "en" => array:2 [ "titulo" => "Abstract" "resumen" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">The most common deficiency alleles for alpha-1-antitrypsin deficiency (AATD) are Pi*S and Pi*S, but there are also other deficiency variants.</p><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">This case report describes the first two cases of AATD detected in Spain resulting from the combination of a null Mattawa allele with a normal PI*M, and a rare Mmalton.</p><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Both cases were initially diagnosed as Pi*MM by isoelectric focusing (IEF), but the low serum AAT values led us to suspect the existence of rare deficiency alleles that were undetectable using this technique, and to performing molecular analysis of the gene, which provided the correct diagnosis.</p><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Inconsistencies between serum AAT values and the phenotype should make one suspect the existence of one of these rare alleles.</p>" ] ] "multimedia" => array:1 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1103 "Ancho" => 2596 "Tamanyo" => 243756 ] ] "descripcion" => array:1 [ "es" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Secuencia correspondiente al exón 5 del gen SERPINA1. A)<span class="elsevierStyleHsp" style=""></span>Secuencia normal. B)<span class="elsevierStyleHsp" style=""></span>Secuencia correspondiente a la paciente, donde se ve la inserción de una timina (T) en vez de una adenina (A) en el codón 376 del exón 5 en heterocigosis, correspondiente al alelo PI-Mattawa. La secuencia codificante del gen SERPINA1 (exones 2 a 5) se analizó utilizando <span class="elsevierStyleItalic">primers</span> previamente descritos para los exones 3 a 5 y <span class="elsevierStyleItalic">primers</span> ex2F 5′ACGTGGTGTCAATCCCTGATCACTG3′ y ex2R 5′TATGGGAACAGCTGG3′ para el exón 2, tomando como referencia comparativa la SERPINA1_Transcript_ENST00000440909.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "Bibliografía" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:12 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "P.I.*S and PI*Z alpha-1 antitrypsin deficiency: Estimated prevalence and number of deficient subjects in Spain" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "I. Blanco" 1 => "E. Fernández-Bustillo" 2 => "F.J. de Serres" 3 => "D. Alkassam" 4 => "C. Rodríguez" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Med Clin (Barc)" "fecha" => "2004" "volumen" => "123" "paginaInicial" => "761" "paginaFinal" => "765" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Normativa sobre diagnóstico y tratamiento del déficit de alfa-1 antitripsina" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "R. Vidal" 1 => "I. Blanco" 2 => "F. Casas" 3 => "R. Jardí" 4 => "M. Miravitlles" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Arch Bronconeumol" "fecha" => "2006" "volumen" => "42" "paginaInicial" => "645" "paginaFinal" => "659" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17178069" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Rare alpha-1 antitrypsin variants: Are they really so rare?" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "F. Rodríguez-Frías" 1 => "M. Miravitlles" 2 => "R. Vidal" 3 => "S. Campos" 4 => "R. Jardi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1177/1753465811434320" "Revista" => array:6 [ "tituloSerie" => "Ther Adv Respir Dis" "fecha" => "2012" "volumen" => "6" "paginaInicial" => "79" "paginaFinal" => "85" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22291048" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "SERPINA1 gen variants in individuals from general population with reduced alpha-1-antitrypsin concentrations" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Zorzetto" 1 => "E. Russi" 2 => "O. Senn" 3 => "M. Imboden" 4 => "I. Ferrarotti" 5 => "C. Tinelli" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1373/clinchem.2007.102798" "Revista" => array:6 [ "tituloSerie" => "Clin Chem" "fecha" => "2008" "volumen" => "54" "paginaInicial" => "1331" "paginaFinal" => "1338" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18515255" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Alpha 1-antitrypsin phenotypes and associated serum protein concentrations in a large clinical population" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J.A. Bornhorst" 1 => "D.N. Greene" 2 => "E.R. Ashwood" 3 => "D.G. Grenache" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1378/chest.12-0564" "Revista" => array:6 [ "tituloSerie" => "Chest" "fecha" => "2013" "volumen" => "143" "paginaInicial" => "1000" "paginaFinal" => "1008" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23632999" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Characterization of the new alpha-1-antitrypsin-deficient PI M-type allele, PI M(vall d’hebron) (Pro(369)→Ser)" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R. Jardí" 1 => "F. Rodríguez-Frías" 2 => "J.C. López-Talavera" 3 => "M. Miravitlles" 4 => "M. Cotrina" 5 => "X. Costa" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "22935" "Revista" => array:6 [ "tituloSerie" => "Hum Hered" "fecha" => "2000" "volumen" => "50" "paginaInicial" => "320" "paginaFinal" => "321" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10878477" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Emphysema due to alpha-antitrypsin deficiency: Familial study of the YBARCELONA variant" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M. Miravitlles" 1 => "S. Vilà" 2 => "R. Jardí" 3 => "C. de la Roza" 4 => "F. Rodríguez-Frías" 5 => "R. Vidal" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Chest" "fecha" => "2003" "volumen" => "124" "paginaInicial" => "404" "paginaFinal" => "406" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12853554" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Alpha-1-antitrypsin deficiency caused by the alpha-1-antitrypsin null(Mattawa) gene: An insertion mutation rendering the alpha-1-antitrypsin gene incapable of producing alpha-1-antitrypsin" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "D. Curiel" 1 => "M. Brantly" 2 => "E. Curiel" 3 => "L. Stier" 4 => "R.G. Crystal" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1172/JCI113994" "Revista" => array:6 [ "tituloSerie" => "J Clin Invest" "fecha" => "1989" "volumen" => "83" "paginaInicial" => "1144" "paginaFinal" => "1152" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2539391" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Emphysema of early onset associated with a complete deficiency of alpha-1-antitrypsin (null homozygotes)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "D.W. Cox" 1 => "H. Levison" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1164/ajrccm/137.2.371" "Revista" => array:6 [ "tituloSerie" => "Am Rev Respir Dis" "fecha" => "1988" "volumen" => "137" "paginaInicial" => "371" "paginaFinal" => "375" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/3257661" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Development and results of the Spanish Registry of patients with alpha-1-antitrypsin deficiency" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "B. Lara" 1 => "C. de la Roza" 2 => "S. Vilà" 3 => "R. Vidal" 4 => "M. Miravitlles" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Int J COPD" "fecha" => "2007" "volumen" => "2" "paginaInicial" => "1" "paginaFinal" => "6" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "In-frame single codon deletion in the M(Malton) deficiency allele of alpha-1-antitrypsin" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "G.C. Fraizer" 1 => "T.R. Harrold" 2 => "M.H. Hofker" 3 => "D.W. Cox" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Am J Hum Genet" "fecha" => "1989" "volumen" => "44" "paginaInicial" => "894" "paginaFinal" => "902" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2786335" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular characterisation of three alpha-1-antitrypsin deficiency variants: Proteinase inhibitor (Pi) Null (Cardiff) (asp256-to-val), Pi M(Malton) (phe51-deletion) and Pi I (arg39-to-cys)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A. Graham" 1 => "N.A. Kalsheker" 2 => "C.R. Newton" 3 => "F.J. Bamforth" 4 => "S.J. Powell" 5 => "A.F. Markham" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Hum Genet" "fecha" => "1989" "volumen" => "84" "paginaInicial" => "55" "paginaFinal" => "58" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2606478" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:3 [ "titulo" => "Agradecimientos" "texto" => "<p id="par0070" class="elsevierStylePara elsevierViewall">Los autores agradecen al Dr. Ignacio Blanco su importante contribución a la redacción de este artículo.</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "es" "url" => "/03002896/0000004900000012/v1_201312040037/S030028961300152X/v1_201312040037/es/main.assets" "Apartado" => array:4 [ "identificador" => "9217" "tipo" => "SECCION" "es" => array:2 [ "titulo" => "Notas clínicas" "idiomaDefecto" => true ] "idiomaDefecto" => "es" ] "PDF" => "https://static.elsevier.es/multimedia/03002896/0000004900000012/v1_201312040037/S030028961300152X/v1_201312040037/es/main.pdf?idApp=UINPBA00003Z&text.app=https://archbronconeumol.org/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S030028961300152X?idApp=UINPBA00003Z" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 October | 40 | 15 | 55 |
| 2024 September | 50 | 15 | 65 |
| 2024 August | 87 | 35 | 122 |
| 2024 July | 59 | 22 | 81 |
| 2024 June | 96 | 28 | 124 |
| 2024 May | 85 | 29 | 114 |
| 2024 April | 79 | 26 | 105 |
| 2024 March | 91 | 22 | 113 |
| 2024 February | 67 | 33 | 100 |
| 2023 December | 1 | 0 | 1 |
| 2023 March | 33 | 5 | 38 |
| 2023 February | 58 | 24 | 82 |
| 2023 January | 58 | 27 | 85 |
| 2022 December | 105 | 29 | 134 |
| 2022 November | 88 | 34 | 122 |
| 2022 October | 88 | 34 | 122 |
| 2022 September | 82 | 45 | 127 |
| 2022 August | 63 | 43 | 106 |
| 2022 July | 67 | 59 | 126 |
| 2022 June | 67 | 35 | 102 |
| 2022 May | 47 | 40 | 87 |
| 2022 April | 71 | 34 | 105 |
| 2022 March | 65 | 54 | 119 |
| 2022 February | 61 | 45 | 106 |
| 2022 January | 81 | 46 | 127 |
| 2021 December | 44 | 43 | 87 |
| 2021 November | 66 | 49 | 115 |
| 2021 October | 88 | 50 | 138 |
| 2021 September | 48 | 36 | 84 |
| 2021 August | 57 | 35 | 92 |
| 2021 July | 56 | 35 | 91 |
| 2021 June | 55 | 39 | 94 |
| 2021 May | 48 | 54 | 102 |
| 2021 April | 96 | 87 | 183 |
| 2021 March | 76 | 34 | 110 |
| 2021 February | 51 | 29 | 80 |
| 2021 January | 46 | 34 | 80 |
| 2020 December | 68 | 38 | 106 |
| 2020 November | 37 | 30 | 67 |
| 2020 October | 46 | 26 | 72 |
| 2020 September | 56 | 33 | 89 |
| 2020 August | 55 | 21 | 76 |
| 2020 July | 64 | 28 | 92 |
| 2020 June | 49 | 14 | 63 |
| 2020 May | 55 | 23 | 78 |
| 2020 April | 58 | 15 | 73 |
| 2020 March | 55 | 17 | 72 |
| 2020 February | 59 | 20 | 79 |
| 2020 January | 61 | 12 | 73 |
| 2019 December | 57 | 25 | 82 |
| 2019 November | 34 | 20 | 54 |
| 2019 October | 42 | 27 | 69 |
| 2019 September | 68 | 32 | 100 |
| 2019 August | 37 | 30 | 67 |
| 2019 July | 50 | 17 | 67 |
| 2019 June | 46 | 14 | 60 |
| 2019 May | 73 | 28 | 101 |
| 2019 April | 88 | 31 | 119 |
| 2019 March | 60 | 20 | 80 |
| 2019 February | 52 | 16 | 68 |
| 2019 January | 36 | 6 | 42 |
| 2018 December | 47 | 31 | 78 |
| 2018 November | 106 | 24 | 130 |
| 2018 October | 204 | 23 | 227 |
| 2018 September | 110 | 10 | 120 |
| 2018 August | 2 | 0 | 2 |
| 2018 July | 1 | 0 | 1 |
| 2018 May | 49 | 1 | 50 |
| 2018 April | 88 | 8 | 96 |
| 2018 March | 89 | 6 | 95 |
| 2018 February | 85 | 9 | 94 |
| 2018 January | 85 | 5 | 90 |
| 2017 December | 47 | 11 | 58 |
| 2017 November | 49 | 3 | 52 |
| 2017 October | 42 | 6 | 48 |
| 2017 September | 54 | 4 | 58 |
| 2017 August | 74 | 7 | 81 |
| 2017 July | 65 | 4 | 69 |
| 2017 June | 68 | 9 | 77 |
| 2017 May | 81 | 6 | 87 |
| 2017 April | 69 | 5 | 74 |
| 2017 March | 64 | 13 | 77 |
| 2017 February | 39 | 4 | 43 |
| 2017 January | 24 | 5 | 29 |
| 2016 December | 41 | 6 | 47 |
| 2016 November | 88 | 13 | 101 |
| 2016 October | 84 | 19 | 103 |
| 2016 September | 70 | 10 | 80 |
| 2016 August | 57 | 13 | 70 |
| 2016 July | 104 | 25 | 129 |
| 2016 June | 101 | 17 | 118 |
| 2016 May | 72 | 9 | 81 |
| 2016 April | 51 | 2 | 53 |
| 2016 March | 62 | 4 | 66 |
| 2016 February | 71 | 5 | 76 |
| 2016 January | 94 | 28 | 122 |
| 2015 December | 106 | 18 | 124 |
| 2015 November | 104 | 11 | 115 |
| 2015 October | 129 | 2 | 131 |
| 2015 September | 84 | 0 | 84 |
| 2015 August | 97 | 0 | 97 |
| 2015 July | 108 | 0 | 108 |
| 2015 June | 93 | 0 | 93 |
| 2015 May | 103 | 0 | 103 |
| 2015 April | 92 | 0 | 92 |
| 2015 March | 108 | 0 | 108 |
| 2015 February | 77 | 0 | 77 |
| 2015 January | 104 | 0 | 104 |
| 2014 December | 68 | 0 | 68 |
| 2014 November | 72 | 0 | 72 |
| 2014 October | 79 | 0 | 79 |
| 2014 September | 67 | 0 | 67 |
| 2014 August | 74 | 0 | 74 |
| 2014 July | 57 | 0 | 57 |
| 2014 June | 86 | 0 | 86 |
| 2014 May | 83 | 0 | 83 |
| 2014 April | 98 | 0 | 98 |
| 2014 March | 99 | 0 | 99 |
| 2014 February | 6 | 0 | 6 |
| 2014 January | 12 | 0 | 12 |
| 2013 December | 41 | 0 | 41 |
Show all
